Gene/Protein Characteristic Table for KIAA0234
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00039
Accession No D87072
Description Histone demethylase JARID1D (EC 1.14.11.-)(Jumonji/ARID domain-containing protein 1D)(Protein SmcY)(Histocompatibility Y antigen)(H-Y)
Clone name ha02764
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
ORF sequence DNA sequence (5134 bp)
Protein sequence (1512 aa)
Flexi ORF Clone FXC00039
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0234 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5134 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 575 bp
Genome contig ID gi89161220r_20226694
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TGTTAAAAATAAAACAATGAGTATGTTTGGATACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGAATATGATTTGAACTTCTTAAATTGTACGAGTGAAGGACTGAGGTTA
Features of the protein sequence
Description

Length: 1512 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW54663 0 100.0 Smcy homolog, Y...
Homo sapiens
Q9BY66 0 96.3 Histone demethy...
Homo sapiens
AAC50806 0 96.0 SMCY.
Homo sapiens
Q5XUN4 0 95.1 Histone demethy...
Pan troglodytes
ACL51656 0 88.2 jumonji AT-rich...
Callithrix jacchus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB014577 1.3e-16 33.6 KIAA0677
AB018323 5.4e-16 33.2 KIAA0780
AB020683 1e-15 33.9 KIAA0876
AB040975 1.8e-06 45.2 KIAA1542
AB040909 1.9e-05 23.3 KIAA1476
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003349 45 89 PF02375 Transcription factor jumonji
IPR001606 106 202 PF01388 AT-rich interaction region
IPR001965 289 337 PF00628 Zinc finger
IPR013129 464 580 PF02373 Transcription factor jumonji
IPR004198 670 723 PF02928 Zinc finger
IPR013637 734 1060 PF08429 PLU-1-like
IPR001965 1147 1210 PF00628 Zinc finger
HMMSmart IPR003349 43 84 SM00545 Transcription factor jumonji
IPR001965 289 335 SM00249 Zinc finger
IPR003347 431 597 SM00558 Transcription factor jumonji/aspartyl beta-hydroxylase
IPR001965 1147 1208 SM00249 Zinc finger
ProfileScan IPR003349 44 85 PS51183 Transcription factor jumonji
IPR001965 287 337 PS50016 Zinc finger
IPR003347 431 597 PS51184 Transcription factor jumonji/aspartyl beta-hydroxylase
ScanRegExp IPR001965 290 334 PS01359 Zinc finger
IPR001965 1148 1207 PS01359 Zinc finger
Expression profile
Description

Northern blot

RH mapping information
Description

Chromosome No. Y
Experimental conditions
Panel name CCR
Primer_f ACCCCGATGCTCAGAAGTGTC
Primer_r TACAGAAAGAGGGTGGTGGGG
PCR product length 157 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp