|
Order Kazusa clone(s) from : |
| Product ID | ORK00039 |
|---|---|
| Accession No | D87072 |
| Description | Histone demethylase JARID1D (EC 1.14.11.-)(Jumonji/ARID domain-containing protein 1D)(Protein SmcY)(Histocompatibility Y antigen)(H-Y) |
| Clone name | ha02764 |
| Vector information | |
| ORF sequence | DNA sequence (5134 bp) Protein sequence (1512 aa) |
|
HaloTag ORF Clone |
FHC00039
|
| Flexi ORF Clone | FXC00039 |
| Source | Myeloblast cell line (KG-1) |
| Rouge ID |
mKIAA0234
by Kazusa Mouse cDNA Project
|
Length: 5134 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 575 bp |
|---|---|
| Genome contig ID | gi89161220r_20226694 |
| PolyA signal sequence (AATAAA,-28) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Length: 1512 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR003349 | 45 | 89 | PF02375 | Transcription factor jumonji |
| IPR001606 | 106 | 202 | PF01388 | AT-rich interaction region | |
| IPR001965 | 289 | 337 | PF00628 | Zinc finger | |
| IPR013129 | 464 | 580 | PF02373 | Transcription factor jumonji | |
| IPR004198 | 670 | 723 | PF02928 | Zinc finger | |
| IPR013637 | 734 | 1060 | PF08429 | PLU-1-like | |
| IPR001965 | 1147 | 1210 | PF00628 | Zinc finger | |
| HMMSmart | IPR003349 | 43 | 84 | SM00545 | Transcription factor jumonji |
| IPR001965 | 289 | 335 | SM00249 | Zinc finger | |
| IPR003347 | 431 | 597 | SM00558 | Transcription factor jumonji/aspartyl beta-hydroxylase | |
| IPR001965 | 1147 | 1208 | SM00249 | Zinc finger | |
| ProfileScan | IPR003349 | 44 | 85 | PS51183 | Transcription factor jumonji |
| IPR001965 | 287 | 337 | PS50016 | Zinc finger | |
| IPR003347 | 431 | 597 | PS51184 | Transcription factor jumonji/aspartyl beta-hydroxylase | |
| ScanRegExp | IPR001965 | 290 | 334 | PS01359 | Zinc finger |
| IPR001965 | 1148 | 1207 | PS01359 | Zinc finger |
Chromosome No. Y
Experimental conditions| Panel name | CCR |
|---|---|
| Primer_f | ACCCCGATGCTCAGAAGTGTC |
| Primer_r | TACAGAAAGAGGGTGGTGGGG |
| PCR product length | 157 bp |
| PCR conditions | 95 °C 15 sec 66 °C 60 sec 30 cycles |