KIAA1476

Product ID	ORK04255
Accession No	AB040909
Description	bromodomain adjacent to zinc finger domain, 2B
Clone name	fj04778s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7985 bp) Predicted protein sequence (2142 aa)
Source	Human fetal brain
Rouge ID	mKIAA1476 by Kazusa Mouse cDNA Project
Note	We replaced fj04778, former representative clones for KIAA1476 with fj04778s1. (2003/4/2)

Length: 7985 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1213 bp
Genome contig ID	gi89161199r_159783809
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAGTTTTATTTAAAATAAAATGTTGTGGAAAAGGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCATTCTTTTTTTAGGAGTGTTATTTTTCACTATGTGTGGCACGGATAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	159883809	160181326	36	99.8	Perfect prediction

Length: 2142 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_856656	96.0	similar to Brom...	Canis lupus fam...
XP_848667	94.5	similar to Brom...	Canis lupus fam...
XP_856693	92.0	similar to Brom...	Canis lupus fam...
CAM26914	84.4	bromodomain adj...	Mus musculus
EAX11404	98.3	bromodomain adj...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002312	1.2e-17	36.6	KIAA0314

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	2054	2067	PR00503	Bromodomain
	IPR001487	2068	2084	PR00503	Bromodomain
	IPR001487	2084	2102	PR00503	Bromodomain
	IPR001487	2102	2121	PR00503	Bromodomain
HMMPfam	IPR001739	747	796	PF01429	Methyl-CpG binding
	IPR004022	1062	1123	PF02791	DDT
	IPR001965	1907	1955	PF00628	Zinc finger
	IPR001487	2038	2126	PF00439	Bromodomain
HMMSmart	IPR001739	750	820	SM00391	Methyl-CpG binding
	IPR004022	1061	1126	SM00571	DDT
	IPR001965	1907	1953	SM00249	Zinc finger
	IPR001487	2032	2140	SM00297	Bromodomain
ProfileScan	IPR001739	747	822	PS50982	Methyl-CpG binding
	IPR004022	1061	1126	PS50827	DDT
	IPR001965	1905	1955	PS50016	Zinc finger
	IPR001487	2051	2121	PS50014	Bromodomain
ScanRegExp	IPR001487	2056	2113	PS00633	Bromodomain

Primer_f	CATTATCAGAAGCTCGCAGTG
Primer_r	CCCTTTCGACAGATTTGGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TAGTCTTTTGCCACGAACACC
Primer_r	AGATACTCCACCTTTCACCTG
PCR product length	202(600) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles