Order Kazusa clone(s) from : ![]() |
Product ID | ORK00669 |
---|---|
Accession No | AB020683 |
Description | lysine (K)-specific demethylase 4B |
Clone name | hh03683 |
Vector information | |
cDNA sequence | DNA sequence (5595 bp) Predicted protein sequence (1119 aa) |
HaloTag ORF Clone |
FHC00669
![]() |
Flexi ORF Clone | FXC00669 |
Source | Human adult brain |
Rouge ID |
mKIAA0876
by Kazusa Mouse cDNA Project
|
Note | We replaced hk07354, former representative clones for KIAA0876 with hh03683. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2086 bp |
---|---|
Genome contig ID | gi42406306f_4820132 |
PolyA signal sequence (ATTAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (284476 - 284525) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 4920132 | 5104606 | 23 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003349 | 39 | 84 | PF02375 | Transcription factor jumonji |
IPR013129 | 199 | 315 | PF02373 | Transcription factor jumonji | |
IPR001965 | 780 | 814 | PF00628 | Zinc finger | |
HMMSmart | IPR003349 | 37 | 79 | SM00545 | Transcription factor jumonji |
IPR003347 | 166 | 332 | SM00558 | Transcription factor jumonji/aspartyl beta-hydroxylase | |
IPR001965 | 754 | 812 | SM00249 | Zinc finger | |
IPR001965 | 874 | 930 | SM00249 | Zinc finger | |
IPR002999 | 940 | 997 | SM00333 | Tudor | |
IPR002999 | 998 | 1054 | SM00333 | Tudor | |
ProfileScan | IPR003349 | 38 | 80 | PS51183 | Transcription factor jumonji |
IPR003347 | 169 | 332 | PS51184 | Transcription factor jumonji/aspartyl beta-hydroxylase |
![]() |
Primer_f | GCCCTTCTGGTTGGTAGTGAG |
---|---|
Primer_r | TTCTCTATCAGCTCAACCCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCCCTTCTGGTTGGTAGTGAG |
Primer_r | TTCTCTATCAGCTCAACCCAC |
PCR product length | 212 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |