Order Kazusa clone(s) from : ![]() |
Product ID | ORK00860 |
---|---|
Accession No | AB040975 |
Description | PHD and ring finger domains 1, transcript variant 2 |
Clone name | hh03408 |
Vector information | |
cDNA sequence | DNA sequence (5521 bp) Predicted protein sequence (1654 aa) |
HaloTag ORF Clone |
FHC00860
![]() |
Flexi ORF Clone | FXC00860 |
Source | Human adult brain |
Rouge ID |
mKIAA1542
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 443 bp |
---|---|
Genome contig ID | gi51511727f_466523 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (135699 - 135748) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 566486 | 602220 | 18 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001841 | 113 | 153 | PF00097 | Zinc finger |
IPR001965 | 190 | 238 | PF00628 | Zinc finger | |
HMMSmart | IPR001841 | 113 | 153 | SM00184 | Zinc finger |
IPR001965 | 190 | 236 | SM00249 | Zinc finger | |
IPR001841 | 191 | 235 | SM00184 | Zinc finger | |
ProfileScan | IPR001841 | 113 | 154 | PS50089 | Zinc finger |
IPR001965 | 188 | 238 | PS50016 | Zinc finger | |
ScanRegExp | IPR001841 | 131 | 140 | PS00518 | Zinc finger |
IPR001965 | 159 | 235 | PS01359 | Zinc finger |
![]() |
Primer_f | ACAGTGACAGCGAGCATGGAG |
---|---|
Primer_r | GCCTGGTCTCTGAATGCGTTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCAAGAGTGGAGAGATCAACC |
Primer_r | GCGCATGTGCCTGTACTTGTC |
PCR product length | 78 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |