Order Kazusa clone(s) from : ![]() |
Product ID | ORK00949 |
---|---|
Accession No | AB067503 |
Description | leucine-rich repeat LGI family, member 2 |
Clone name | hg01117 |
Vector information | |
cDNA sequence | DNA sequence (6234 bp) Predicted protein sequence (542 aa) |
HaloTag ORF Clone |
FHC00949
![]() |
Flexi ORF Clone | FXC00949 |
Source | Human adult brain |
Rouge ID |
mKIAA1916
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4604 bp |
---|---|
Genome contig ID | gi89161207r_24509569 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | r | 24609569 | 24641405 | 8 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 132 | 145 | PR00019 | Leucine-rich repeat |
IPR001611 | 153 | 166 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 83 | 105 | PF00560 | Leucine-rich repeat |
IPR001611 | 107 | 129 | PF00560 | Leucine-rich repeat | |
IPR001611 | 131 | 153 | PF00560 | Leucine-rich repeat | |
IPR005492 | 217 | 257 | PF03736 | EPTP | |
IPR005492 | 405 | 446 | PF03736 | EPTP | |
HMMSmart | IPR003591 | 81 | 104 | SM00369 | Leucine-rich repeat |
IPR003591 | 105 | 128 | SM00369 | Leucine-rich repeat | |
IPR003591 | 129 | 152 | SM00369 | Leucine-rich repeat | |
IPR000483 | 164 | 213 | SM00082 | Cysteine-rich flanking region | |
ProfileScan | IPR009039 | 215 | 258 | PS50912 | EAR |
IPR009039 | 261 | 304 | PS50912 | EAR | |
IPR009039 | 307 | 355 | PS50912 | EAR | |
IPR009039 | 356 | 400 | PS50912 | EAR | |
IPR009039 | 403 | 447 | PS50912 | EAR | |
IPR009039 | 448 | 491 | PS50912 | EAR | |
IPR009039 | 494 | 537 | PS50912 | EAR |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 6 | GALGLLLLLLGAACLIPRSAQV | 27 | PRIMARY | 22 |
---|
![]() |
Primer_f | TTCATCAGACTTTACCCTACC |
---|---|
Primer_r | ATGGACTGACCTGTAATGTTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |