KIAA1916

Product ID	ORK00949
Accession No	AB067503
Description	leucine-rich repeat LGI family, member 2
Clone name	hg01117
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6234 bp) Predicted protein sequence (542 aa)
HaloTag ORF Clone	FHC00949
Flexi ORF Clone	FXC00949
Source	Human adult brain
Rouge ID	mKIAA1916 by Kazusa Mouse cDNA Project

Length: 6234 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4604 bp
Genome contig ID	gi89161207r_24509569
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TCGGTAAGCCTATGAATAAAAAGTGGTTCATGCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATATGGTTTTGATCTCTGGTCTGCTTAATATGAATATGGCCACTTGAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	24609569	24641405	8	99.1	Perfect prediction

Length: 542 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAD32305	100.0	LGI1-like prote...	Homo sapiens
Q8N0V4	99.8	Leucine-rich re...	Homo sapiens
XP_001082016	99.3	similar to leuc...	Macaca mulatta
XP_614279	97.0	similar to leuc...	Bos taurus
AAI68885	97.4	Lgi2 protein [R...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011538	2e-17	31.1	KIAA0814
AB011537	1e-13	29.0	KIAA0813
AB018349	1.2e-13	32.8	KIAA0806
AB046800	8.4e-13	31.4	KIAA1580
AB040902	1.3e-12	29.0	KIAA1469

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	132	145	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	153	166	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	83	105	PF00560	Leucine-rich repeat
	IPR001611	107	129	PF00560	Leucine-rich repeat
	IPR001611	131	153	PF00560	Leucine-rich repeat
	IPR005492	217	257	PF03736	EPTP
	IPR005492	405	446	PF03736	EPTP
HMMSmart	IPR003591	81	104	SM00369	Leucine-rich repeat
	IPR003591	105	128	SM00369	Leucine-rich repeat
	IPR003591	129	152	SM00369	Leucine-rich repeat
	IPR000483	164	213	SM00082	Cysteine-rich flanking region
ProfileScan	IPR009039	215	258	PS50912	EAR
	IPR009039	261	304	PS50912	EAR
	IPR009039	307	355	PS50912	EAR
	IPR009039	356	400	PS50912	EAR
	IPR009039	403	447	PS50912	EAR
	IPR009039	448	491	PS50912	EAR
	IPR009039	494	537	PS50912	EAR

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	6	GALGLLLLLLGAACLIPRSAQV	27	PRIMARY	22

Primer_f	TTCATCAGACTTTACCCTACC
Primer_r	ATGGACTGACCTGTAATGTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-