Order Kazusa clone(s) from : ![]() |
Product ID | ORK00234 |
---|---|
Accession No | AB040902 |
Description | fibronectin leucine rich transmembrane protein 3, transcript variant 1 |
Clone name | fj01881 |
Vector information | |
cDNA sequence | DNA sequence (4723 bp) Predicted protein sequence (662 aa) |
HaloTag ORF Clone |
FHC00234
![]() |
Flexi ORF Clone | FXC00234 |
Source | Human fetal brain |
Rouge ID |
mKIAA1469
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 169 | 182 | PR00019 | Leucine-rich repeat |
IPR001611 | 283 | 296 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR000372 | 43 | 70 | PF01462 | Leucine-rich repeat |
IPR001611 | 72 | 95 | PF00560 | Leucine-rich repeat | |
IPR001611 | 97 | 115 | PF00560 | Leucine-rich repeat | |
IPR001611 | 142 | 166 | PF00560 | Leucine-rich repeat | |
IPR001611 | 168 | 186 | PF00560 | Leucine-rich repeat | |
IPR001611 | 189 | 211 | PF00560 | Leucine-rich repeat | |
IPR001611 | 213 | 237 | PF00560 | Leucine-rich repeat | |
IPR001611 | 239 | 257 | PF00560 | Leucine-rich repeat | |
IPR001611 | 261 | 283 | PF00560 | Leucine-rich repeat | |
IPR001611 | 285 | 307 | PF00560 | Leucine-rich repeat | |
IPR000483 | 344 | 369 | PF01463 | Cysteine-rich flanking region | |
IPR003961 | 418 | 498 | PF00041 | Fibronectin | |
HMMSmart | IPR000372 | 43 | 75 | SM00013 | Leucine-rich repeat |
IPR003591 | 95 | 118 | SM00369 | Leucine-rich repeat | |
IPR003591 | 140 | 165 | SM00369 | Leucine-rich repeat | |
IPR003591 | 169 | 189 | SM00369 | Leucine-rich repeat | |
IPR003591 | 211 | 236 | SM00369 | Leucine-rich repeat | |
IPR003591 | 237 | 260 | SM00369 | Leucine-rich repeat | |
IPR003591 | 261 | 282 | SM00369 | Leucine-rich repeat | |
IPR003591 | 283 | 306 | SM00369 | Leucine-rich repeat | |
IPR000483 | 318 | 369 | SM00082 | Cysteine-rich flanking region | |
ProfileScan | IPR003961 | 419 | 514 | PS50853 | Fibronectin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 12 | LTMISAAWSIFLIGTKIGLFLQV | 34 | PRIMARY | 23 | 2 | 542 | LAAIIGGAVALVTIALLALVCWY | 564 | PRIMARY | 23 |
---|
![]() |
Primer_f | CAAAGATCAAGAATACTGCCC |
---|---|
Primer_r | ACATACAAGACTGGCCAAAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |