Order Kazusa clone(s) from : ![]() |
Product ID | ORK00644 |
---|---|
Accession No | AB011537 |
Description | slit guidance ligand 1 |
Clone name | pf00581 |
Vector information | |
cDNA sequence | DNA sequence (7931 bp) Predicted protein sequence (1618 aa) |
HaloTag ORF Clone |
FHC00644
![]() |
Flexi ORF Clone | FXC00644 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA0813
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00849, former representative clones for KIAA0813 with pf00581. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3074 bp |
---|---|
Genome contig ID | gi89161187r_98647785 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 98747785 | 98935673 | 37 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 219 | 232 | PR00019 | Leucine-rich repeat |
IPR001611 | 648 | 661 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR000372 | 117 | 144 | PF01462 | Leucine-rich repeat |
IPR001611 | 146 | 168 | PF00560 | Leucine-rich repeat | |
IPR001611 | 170 | 192 | PF00560 | Leucine-rich repeat | |
IPR001611 | 194 | 216 | PF00560 | Leucine-rich repeat | |
IPR001611 | 218 | 240 | PF00560 | Leucine-rich repeat | |
IPR001611 | 242 | 264 | PF00560 | Leucine-rich repeat | |
IPR001611 | 266 | 288 | PF00560 | Leucine-rich repeat | |
IPR000483 | 323 | 348 | PF01463 | Cysteine-rich flanking region | |
IPR000372 | 365 | 392 | PF01462 | Leucine-rich repeat | |
IPR001611 | 418 | 440 | PF00560 | Leucine-rich repeat | |
IPR001611 | 442 | 464 | PF00560 | Leucine-rich repeat | |
IPR001611 | 466 | 488 | PF00560 | Leucine-rich repeat | |
IPR001611 | 490 | 512 | PF00560 | Leucine-rich repeat | |
IPR000483 | 547 | 572 | PF01463 | Cysteine-rich flanking region | |
IPR000372 | 596 | 623 | PF01462 | Leucine-rich repeat | |
IPR001611 | 650 | 672 | PF00560 | Leucine-rich repeat | |
IPR001611 | 674 | 696 | PF00560 | Leucine-rich repeat | |
IPR001611 | 698 | 720 | PF00560 | Leucine-rich repeat | |
IPR001611 | 722 | 744 | PF00560 | Leucine-rich repeat | |
IPR000483 | 779 | 804 | PF01463 | Cysteine-rich flanking region | |
IPR000372 | 817 | 844 | PF01462 | Leucine-rich repeat | |
IPR001611 | 846 | 867 | PF00560 | Leucine-rich repeat | |
IPR001611 | 869 | 891 | PF00560 | Leucine-rich repeat | |
IPR001611 | 893 | 915 | PF00560 | Leucine-rich repeat | |
IPR001611 | 917 | 939 | PF00560 | Leucine-rich repeat | |
IPR000483 | 974 | 999 | PF01463 | Cysteine-rich flanking region | |
IPR006209 | 1013 | 1045 | PF00008 | EGF-like | |
IPR006209 | 1052 | 1086 | PF00008 | EGF-like | |
IPR006209 | 1093 | 1124 | PF00008 | EGF-like | |
IPR006209 | 1131 | 1164 | PF00008 | EGF-like | |
IPR006209 | 1171 | 1202 | PF00008 | EGF-like | |
IPR006209 | 1215 | 1246 | PF00008 | EGF-like | |
IPR012680 | 1278 | 1406 | PF02210 | Laminin G | |
IPR006209 | 1426 | 1457 | PF00008 | EGF-like | |
IPR006209 | 1465 | 1496 | PF00008 | EGF-like | |
IPR006209 | 1506 | 1537 | PF00008 | EGF-like | |
HMMSmart | IPR000372 | 117 | 149 | SM00013 | Leucine-rich repeat |
IPR003591 | 143 | 167 | SM00369 | Leucine-rich repeat | |
IPR003591 | 168 | 191 | SM00369 | Leucine-rich repeat | |
IPR003591 | 192 | 215 | SM00369 | Leucine-rich repeat | |
IPR003591 | 217 | 239 | SM00369 | Leucine-rich repeat | |
NULL | 240 | 261 | SM00365 | NULL | |
IPR003591 | 241 | 263 | SM00369 | Leucine-rich repeat | |
IPR003591 | 264 | 287 | SM00369 | Leucine-rich repeat | |
IPR000483 | 299 | 348 | SM00082 | Cysteine-rich flanking region | |
IPR000372 | 365 | 397 | SM00013 | Leucine-rich repeat | |
IPR003591 | 391 | 415 | SM00369 | Leucine-rich repeat | |
NULL | 416 | 437 | SM00365 | NULL | |
IPR003591 | 416 | 439 | SM00369 | Leucine-rich repeat | |
IPR003591 | 440 | 463 | SM00369 | Leucine-rich repeat | |
IPR003591 | 464 | 487 | SM00369 | Leucine-rich repeat | |
NULL | 488 | 506 | SM00365 | NULL | |
IPR003591 | 488 | 511 | SM00369 | Leucine-rich repeat | |
IPR000483 | 523 | 572 | SM00082 | Cysteine-rich flanking region | |
IPR000372 | 596 | 628 | SM00013 | Leucine-rich repeat | |
NULL | 648 | 669 | SM00365 | NULL | |
IPR003591 | 648 | 671 | SM00369 | Leucine-rich repeat | |
IPR003591 | 673 | 695 | SM00369 | Leucine-rich repeat | |
NULL | 696 | 717 | SM00365 | NULL | |
IPR003591 | 696 | 719 | SM00369 | Leucine-rich repeat | |
NULL | 720 | 741 | SM00365 | NULL | |
IPR003591 | 720 | 743 | SM00369 | Leucine-rich repeat | |
IPR000483 | 755 | 804 | SM00082 | Cysteine-rich flanking region | |
IPR000372 | 817 | 849 | SM00013 | Leucine-rich repeat | |
NULL | 867 | 888 | SM00365 | NULL | |
IPR003591 | 867 | 890 | SM00369 | Leucine-rich repeat | |
NULL | 891 | 912 | SM00365 | NULL | |
IPR003591 | 891 | 914 | SM00369 | Leucine-rich repeat | |
IPR003591 | 915 | 938 | SM00369 | Leucine-rich repeat | |
IPR000483 | 950 | 999 | SM00082 | Cysteine-rich flanking region | |
IPR001881 | 1009 | 1046 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 1012 | 1046 | SM00181 | EGF | |
IPR001881 | 1048 | 1087 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 1051 | 1087 | SM00181 | EGF | |
IPR001881 | 1089 | 1125 | SM00179 | EGF-like calcium-binding | |
IPR003645 | 1092 | 1114 | SM00274 | Follistatin-like | |
IPR006210 | 1092 | 1125 | SM00181 | EGF | |
IPR001881 | 1128 | 1165 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 1130 | 1165 | SM00181 | EGF | |
IPR001881 | 1167 | 1203 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 1170 | 1203 | SM00181 | EGF | |
IPR003645 | 1170 | 1192 | SM00274 | Follistatin-like | |
IPR006210 | 1214 | 1247 | SM00181 | EGF | |
IPR003645 | 1214 | 1236 | SM00274 | Follistatin-like | |
IPR001881 | 1215 | 1247 | SM00179 | EGF-like calcium-binding | |
IPR001791 | 1270 | 1406 | SM00282 | Laminin G | |
IPR006210 | 1425 | 1458 | SM00181 | EGF | |
IPR006210 | 1464 | 1497 | SM00181 | EGF | |
IPR001881 | 1465 | 1497 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 1505 | 1538 | SM00181 | EGF | |
IPR003645 | 1505 | 1527 | SM00274 | Follistatin-like | |
IPR006207 | 1549 | 1618 | SM00041 | Cystine knot | |
ProfileScan | IPR000742 | 1011 | 1046 | PS50026 | EGF-like |
IPR000742 | 1048 | 1087 | PS50026 | EGF-like | |
IPR000742 | 1089 | 1125 | PS50026 | EGF-like | |
IPR000742 | 1127 | 1165 | PS50026 | EGF-like | |
IPR000742 | 1167 | 1203 | PS50026 | EGF-like | |
IPR000742 | 1211 | 1247 | PS50026 | EGF-like | |
IPR001791 | 1250 | 1423 | PS50025 | Laminin G | |
IPR000742 | 1424 | 1458 | PS50026 | EGF-like | |
IPR000742 | 1461 | 1497 | PS50026 | EGF-like | |
IPR000742 | 1502 | 1538 | PS50026 | EGF-like | |
IPR006207 | 1543 | 1618 | PS01225 | Cystine knot | |
ScanRegExp | IPR013032 | 1034 | 1045 | PS00022 | EGF-like region |
IPR013032 | 1034 | 1045 | PS01186 | EGF-like region | |
IPR013032 | 1075 | 1086 | PS00022 | EGF-like region | |
IPR013032 | 1075 | 1086 | PS01186 | EGF-like region | |
IPR001881 | 1089 | 1113 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 1104 | 1115 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR013032 | 1113 | 1124 | PS00022 | EGF-like region | |
IPR013032 | 1153 | 1164 | PS00022 | EGF-like region | |
IPR013032 | 1153 | 1164 | PS01186 | EGF-like region | |
IPR001881 | 1167 | 1191 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 1182 | 1193 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR013032 | 1191 | 1202 | PS00022 | EGF-like region | |
IPR013032 | 1191 | 1202 | PS01186 | EGF-like region | |
IPR013032 | 1235 | 1246 | PS00022 | EGF-like region | |
IPR013032 | 1235 | 1246 | PS01186 | EGF-like region | |
IPR013032 | 1446 | 1457 | PS00022 | EGF-like region | |
IPR013032 | 1446 | 1457 | PS01186 | EGF-like region | |
IPR013032 | 1485 | 1496 | PS00022 | EGF-like region | |
IPR013032 | 1485 | 1496 | PS01186 | EGF-like region | |
IPR013032 | 1526 | 1537 | PS00022 | EGF-like region | |
IPR013032 | 1526 | 1537 | PS01186 | EGF-like region | |
IPR006207 | 1581 | 1617 | PS01185 | Cystine knot |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AAACAATACTTCCAGGGCAGG |
Primer_r | TCAGATGCTATGTGGTCGTGG |
PCR product length | 135 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |