KIAA1580

Product ID	ORK00868
Accession No	AB046800
Description	leucine rich repeat containing 4C, transcript variant 1
Clone name	fj04979
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4055 bp) Predicted protein sequence (640 aa)
HaloTag ORF Clone	FHC00868
Flexi ORF Clone	FXC00868
Source	Human fetal brain
Rouge ID	mKIAA1580 by Kazusa Mouse cDNA Project

Length: 4055 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	167 bp
Genome contig ID	gi51511727r_39992329
PolyA signal sequence (ATTAAA,-31)	+--------+--------+----*----+---- ATTTATTAAAAATTCTATTGTGATCTAAAGCAGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATTATGTGTATTCCTCAGAACCTGTTTTTGCTGCACTTATTCACTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	40092329	40272240	2	99.5	Perfect prediction

Length: 640 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001488228	99.7	leucine rich re...	Equus caballus
Q8C031	99.7	Netrin-G1 ligan...	Mus musculus
XP_883747	99.7	similar to netr...	Bos taurus
BAC27884	99.5	unnamed protein...	Mus musculus
XP_540535	99.7	similar to netr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018349	6.7e-19	29.8	KIAA0806
AB007865	1.7e-15	30.0	KIAA0405
D86983	5e-15	27.5	KIAA0230
AB040902	8.1e-15	30.1	KIAA1469
AB007876	8e-13	25.1	KIAA0416

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	221	234	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	266	279	PR00019	Leucine-rich repeat
HMMPfam	IPR000372	46	75	PF01462	Leucine-rich repeat
	IPR001611	77	99	PF00560	Leucine-rich repeat
	IPR001611	101	123	PF00560	Leucine-rich repeat
	IPR001611	125	147	PF00560	Leucine-rich repeat
	IPR001611	149	171	PF00560	Leucine-rich repeat
	IPR001611	198	218	PF00560	Leucine-rich repeat
	IPR001611	220	242	PF00560	Leucine-rich repeat
	IPR001611	268	290	PF00560	Leucine-rich repeat
	IPR013098	354	443	PF07679	Immunoglobulin I-set
HMMSmart	IPR000372	46	80	SM00013	Leucine-rich repeat
	IPR003591	79	98	SM00369	Leucine-rich repeat
	IPR003591	99	122	SM00369	Leucine-rich repeat
	IPR003591	123	146	SM00369	Leucine-rich repeat
	IPR003591	147	170	SM00369	Leucine-rich repeat
	IPR003591	196	217	SM00369	Leucine-rich repeat
	IPR003591	218	241	SM00369	Leucine-rich repeat
	IPR003591	242	265	SM00369	Leucine-rich repeat
	IPR003591	266	289	SM00369	Leucine-rich repeat
	IPR003599	360	444	SM00409	Immunoglobulin subtype
	IPR003598	366	433	SM00408	Immunoglobulin subtype 2
	IPR003596	370	428	SM00406	Immunoglobulin V-set
ProfileScan	IPR007110	354	442	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	22	LFDPLLVVLLALQLLVVAGLVRA	44	PRIMARY	23
SOSUI2	2	523	MKTTKIIIGCFVAITLMAAVMLV	545	PRIMARY	23

Primer_f	AACGGAATGCCTTTGACAACC
Primer_r	GTCACAGTTACAGTTCCAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	RH-map
Primer_f	AACGGAATGCCTTTGACAACC
Primer_r	GTCACAGTTACAGTTCCAAGG
PCR product length	149 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles