KIAA1807

Product ID	ORK06343
Accession No	AB058710
Description	jade family PHD finger 1
Clone name	fk00712
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3140 bp) Predicted protein sequence (702 aa)
Source	Human fetal brain
Rouge ID	mKIAA1807 by Kazusa Mouse cDNA Project

Length: 3140 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1030 bp
Genome contig ID	gi89161207f_129889708
PolyA signal sequence (AAGAAA,-14)	+--------+--------+----*----+---- AAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAAAAG
Flanking genome sequence (124191 - 124240)	----+--------+--------+--------+--------+----* AAAAAAGAAAAAAAGAGAAAAAAGCGAAATAGGTTATATTTTAAAAACAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	129989708	130013897	7	99.4	Perfect prediction

Length: 702 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001158185	100.0	PHD finger prot...	Pan troglodytes
EAX05170	100.0	PHD finger prot...	Homo sapiens
BAC86931	100.0	unnamed protein...	Homo sapiens
BAG65104	100.0	unnamed protein...	Homo sapiens
Q6IE81	100.0	Protein Jade-1;...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87076	7.6e-63	49.4	KIAA0239
D86969	3.8e-60	45.1	KIAA0215
AB033112	2.1e-27	33.7	KIAA1286
AB020683	2.9e-14	38.3	KIAA0876
AB018326	3.1e-13	27.7	KIAA0783

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	65	113	PF00628	Zinc finger
HMMPfam	IPR001965	174	201	PF00628	Zinc finger
HMMSmart	IPR001965	65	111	SM00249	Zinc finger
HMMSmart	IPR001965	174	229	SM00249	Zinc finger
ProfileScan	IPR001965	63	113	PS50016	Zinc finger
ScanRegExp	IPR001965	66	110	PS01359	Zinc finger

Primer_f	AATATAGCAGTCAGGGAAGAG
Primer_r	CTACTTCAACTGCCCTTATTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-