Order Kazusa clone(s) from : ![]() |
Product ID | ORK00474 |
---|---|
Accession No | D87076 |
Description | jade family PHD finger 2, transcript variant 3 |
Clone name | ha06313 |
Vector information | |
cDNA sequence | DNA sequence (6466 bp) Predicted protein sequence (849 aa) |
HaloTag ORF Clone |
FHC00474
![]() |
Flexi ORF Clone | FXC00474 |
Source | Human adult brain |
Rouge ID |
mKIAA0239
by Kazusa Mouse cDNA Project
|
Note | We replaced ha02778, former representative clones for KIAA0239 with ha06313. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 3914 bp |
---|---|
Genome contig ID | gi51511721f_133789697 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (157122 - 157171) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 133889697 | 133946817 | 11 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | TGCTACGGGATCCTCAAGGTG |
Primer_r | CAGCTGACATGCACCCACTTG |
PCR product length | 146 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |