Order Kazusa clone(s) from : ![]() |
Product ID | ORK00463 |
---|---|
Accession No | D86969 |
Description | jade family PHD finger 3, transcript variant 1 |
Clone name | ha02776 |
Vector information | |
cDNA sequence | DNA sequence (4935 bp) Predicted protein sequence (857 aa) |
HaloTag ORF Clone |
FHC00463
![]() |
Flexi ORF Clone | FXC00463 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0215
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2165 bp |
---|---|
Genome contig ID | gi89161218f_46556970 |
PolyA signal sequence (ATTAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (248616 - 248665) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | ACAGTGCTTCAGCCAAATTCC |
Primer_r | GAGCTTATCTTGGAAAACTGG |
PCR product length | 250 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |