ROUGE

Gene/Protein Characteristic Table for mKIAA1807

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129445
Description :	PHD zinc finger protein Jade1. Jade1 PHD finger protein.
Clone Name :	mpm10336 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4719 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2109 bp

Genome contig ID gi65492966f_40894134
PolyA signal sequence
(AATAAA,-14)
+----*----+----*----+----*----+----
AGTTATGCTGAACCAAAAACAAATAAAACAAAATG
Flanking genome sequence
(151551 - 151600)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAATAATAATAAAAAATTTCCCCCACAAAAACATAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1807 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1807	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 58..2610
Length: 850 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6ZPI0	100.0	Protein Jade-1;...	Mus musculus
BAC33688	99.9	unnamed protein...	Mus musculus
EDL35165	99.2	PHD finger prot...	Mus musculus
EDM01351	95.6	PHD finger prot...	Rattus norvegicus
Q6IE81	92.1	Protein Jade-1;...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129091	3.4e-78	45.8	mKIAA0215
AK129097	4.1e-68	49.0	mKIAA0239
AK129233	1.9e-13	37.2	mKIAA0876
AK220233	6.8e-13	25.9	mKIAA4191
AK129187	7.2e-12	34.0	mKIAA0677

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001965 222 270 PF00628 Zinc finger

HMMSmart IPR001965 222 268 SM00249 Zinc finger

IPR001965 331 386 SM00249 Zinc finger

ProfileScan IPR001965 220 270 PS50016 Zinc finger

ScanRegExp IPR001965 223 267 PS01359 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	222	270	PF00628	Zinc finger
HMMSmart	IPR001965	222	268	SM00249	Zinc finger
IPR001965	331	386	SM00249	Zinc finger
ProfileScan	IPR001965	220	270	PS50016	Zinc finger
ScanRegExp	IPR001965	223	267	PS01359	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2109 bp
Genome contig ID	gi65492966f_40894134
PolyA signal sequence (AATAAA,-14)	+--------+--------+----*----+---- AGTTATGCTGAACCAAAAACAAATAAAACAAAATG
Flanking genome sequence (151551 - 151600)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAATAATAATAAAAAATTTCCCCCACAAAAACATAA

Gene/Protein Characteristic Table for mKIAA1807

Features of the cloned DNA sequence

Features of the protein sequence