Order Kazusa clone(s) from : ![]() |
Product ID | ORK02006 |
---|---|
Accession No | AB023161 |
Description | dynein, axonemal, heavy chain 7 |
Clone name | hj04408s1 |
Vector information | |
cDNA sequence | DNA sequence (12418 bp) Predicted protein sequence (4031 aa) |
HaloTag ORF Clone |
FHC02006
![]() |
Flexi ORF Clone | FXC02006 |
Source | Human adult brain |
Note | We replaced hj04408, former representative clones for KIAA0944 with hj04408s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013602 | 761 | 1174 | PF08393 | Dynein heavy chain |
IPR011704 | 1611 | 1762 | PF07728 | ATPase associated with various cellular activities | |
IPR011704 | 1978 | 2125 | PF07728 | ATPase associated with various cellular activities | |
IPR004273 | 3319 | 4028 | PF03028 | Dynein heavy chain | |
HMMSmart | IPR003593 | 1327 | 1466 | SM00382 | AAA+ ATPase |
IPR003593 | 1975 | 2123 | SM00382 | AAA+ ATPase | |
ProfileScan | IPR002048 | 2247 | 2282 | PS50222 | Calcium-binding EF-hand |
ScanRegExp | IPR002048 | 2260 | 2272 | PS00018 | Calcium-binding EF-hand |
IPR002198 | 3447 | 3475 | PS00061 | Short-chain dehydrogenase/reductase SDR |
![]() |
Primer_f | TCTGACCAACCCAAGGAACAC |
---|---|
Primer_r | TCTACTCAGCCAGCCAACAAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCTGACCAACCCAAGGAACAC |
Primer_r | TCTACTCAGCCAGCCAACAAG |
PCR product length | 117 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |