KIAA2017

Product ID	ORK05745
Accession No	AB095937
Description	dynein, axonemal, heavy chain 10
Clone name	fk13965y1
Vector information	The cDNA fragment was inserted at ApaI-NotI site of the pBlu ... The cDNA fragment was inserted at ApaI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCCACGCGT CCG-5' end of cDNA
cDNA sequence	DNA sequence (9388 bp) Predicted protein sequence (3051 aa)
Source	Human fetal brain
Note	We replaced fk13965, former representative clones for KIAA2017 with fk13965y1. (2005/08/06)

Length: 9388 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	232 bp
Genome contig ID	gi89161190f_122783683
PolyA signal sequence (AGTAAA,-17)	+--------+--------+----*----+---- GAATTTATATAATCAAAAAGTAAATATTGGAGAGT
Flanking genome sequence (202532 - 202581)	----+--------+--------+--------+--------+----* ATTTTAAGATGTGTGGAGTTTTCTTTTCCTTCTCAGAGAAAACACTTGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	122883683	122986213	53	100.0	Perfect prediction

Length: 3051 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06722	100.0	DNAH10 variant ...	Homo sapiens
Q8IVF4	100.0	Dynein heavy ch...	Homo sapiens
EAW98437	100.0	hCG1811879 [Hom...	Homo sapiens
NP_997320	100.0	dynein, axonema...	Homo sapiens
XP_001915485	93.5	dynein, axonema...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040936	0	39.6	KIAA1503
AB051484	1.2e-167	34.2	KIAA1697
AB002355	9.6e-132	37.7	KIAA0357
AB023161	1.9e-121	37.1	KIAA0944
AB046823	1.8e-116	35.7	KIAA1603

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013602	1	244	PF08393	Dynein heavy chain
	IPR011704	688	833	PF07728	ATPase associated with various cellular activities
	IPR011704	1030	1177	PF07728	ATPase associated with various cellular activities
	IPR004273	2338	3049	PF03028	Dynein heavy chain
HMMSmart	IPR003593	406	542	SM00382	AAA+ ATPase
	IPR003593	685	821	SM00382	AAA+ ATPase
	IPR003593	1027	1180	SM00382	AAA+ ATPase

Primer_f	CATCCTGTTCTTCGTCCTGTC
Primer_r	AGCGTGTCCATGATGTTCCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-