Order Kazusa clone(s) from : ![]() |
Product ID | ORK05745 |
---|---|
Accession No | AB095937 |
Description | dynein, axonemal, heavy chain 10 |
Clone name | fk13965y1 |
Vector information | |
cDNA sequence | DNA sequence (9388 bp) Predicted protein sequence (3051 aa) |
Source | Human fetal brain |
Note | We replaced fk13965, former representative clones for KIAA2017 with fk13965y1. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 232 bp |
---|---|
Genome contig ID | gi89161190f_122783683 |
PolyA signal sequence (AGTAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (202532 - 202581) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 122883683 | 122986213 | 53 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013602 | 1 | 244 | PF08393 | Dynein heavy chain |
IPR011704 | 688 | 833 | PF07728 | ATPase associated with various cellular activities | |
IPR011704 | 1030 | 1177 | PF07728 | ATPase associated with various cellular activities | |
IPR004273 | 2338 | 3049 | PF03028 | Dynein heavy chain | |
HMMSmart | IPR003593 | 406 | 542 | SM00382 | AAA+ ATPase |
IPR003593 | 685 | 821 | SM00382 | AAA+ ATPase | |
IPR003593 | 1027 | 1180 | SM00382 | AAA+ ATPase |
![]() |
Primer_f | CATCCTGTTCTTCGTCCTGTC |
---|---|
Primer_r | AGCGTGTCCATGATGTTCCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |