KIAA1603

Product ID	ORK04798
Accession No	AB046823
Description	dynein, axonemal, heavy chain 5
Clone name	fj10308y1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6104 bp) Predicted protein sequence (1659 aa)
Source	Human fetal brain
Rouge ID	mKIAA1603 by Kazusa Mouse cDNA Project
Note	We replaced fj10308, former representative clones for KIAA1603 with fj10308y1. (2003/4/2)

Length: 6104 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1123 bp
Genome contig ID	gi51511721r_13643970
PolyA signal sequence (None)	+--------+--------+----*----+---- AATTATAGTTGGCTTGAAAAAATGTGATGATCAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAAAAAATAAAAAAAGGGTAGAAATATTAGACGGTGCGTAGGGACTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	13743970	13833994	27	99.9	Perfect prediction

Length: 1659 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06718	100.0	DNAH5 variant p...	Homo sapiens
EAX08050	100.0	dynein, axonema...	Homo sapiens
Q8TE73	99.9	Dynein heavy ch...	Homo sapiens
XP_001500013	95.7	similar to Dyne...	Equus caballus
XP_848572	94.6	similar to dyne...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037831	3.1e-170	34.9	KIAA1410
AB023161	5e-165	35.0	KIAA0944
AB040936	1.2e-144	37.0	KIAA1503
AB095937	5.3e-112	35.6	KIAA2017
AB002355	6e-95	32.8	KIAA0357

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004273	962	1657	PF03028	Dynein heavy chain

Primer_f	CTGCATAGGTTTTCCCCACTC
Primer_r	TACTACTGTGGATTTGAGGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	RH-map
Primer_f	CTGCATAGGTTTTCCCCACTC
Primer_r	TACTACTGTGGATTTGAGGGC
PCR product length	156 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles