KIAA1997

Product ID	ORK04848
Accession No	AB082528
Description	dynein, cytoplasmic 2, heavy chain 1
Clone name	bj00195y1
Vector information	The cDNA fragment was inserted at the SalI-SacI site of of t ... The cDNA fragment was inserted at the SalI-SacI site of of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The adjacent sequence to the 5'/3' end of the cDNA is as follows: 5'-end: GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CG-5' end of cDNA 3'-end: GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGTT TTTTTTTTTT TTTTTT-3' end of cDNA
cDNA sequence	DNA sequence (5429 bp) Predicted protein sequence (1685 aa)
Source	Human adult brain
Rouge ID	mKIAA1997 by Kazusa Mouse cDNA Project
Note	We replaced bj00195, former representative clones for KIAA1997 with bj00195y1. (2003/4/2)

Length: 5429 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	370 bp
Genome contig ID	gi51511727f_102475193
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGTCATAATTATTTAATAAAAGAGCATTCATAATT
Flanking genome sequence (380370 - 380419)	----+--------+--------+--------+--------+----* TTTGCAGTCTTCCCATGACTCTTTTTACATACTGAAGAATGTATTATAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	102575193	102855561	41	99.9	Perfect prediction

Length: 1685 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06721	100.0	DYNC2H1 variant...	Homo sapiens
Q8NCM8	99.9	Cytoplasmic dyn...	Homo sapiens
NP_001073932	99.5	dynein, cytopla...	Homo sapiens
CAD98012	99.4	hypothetical pr...	Homo sapiens
EDL24928	94.4	dynein cytoplas...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040936	1.4e-97	27.6	KIAA1503
AB095937	6.6e-94	28.1	KIAA2017
AB023161	2.1e-75	27.8	KIAA0944
AB002323	1.6e-70	28.3	KIAA0325
AB037831	4.3e-68	26.0	KIAA1410

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004273	985	1683	PF03028	Dynein heavy chain

Primer_f	TCTCCTGTCCTCAATCTCTGG
Primer_r	GTTCCTCTGATGACTTTGCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-