Order Kazusa clone(s) from : ![]() |
Product ID | ORK00827 |
---|---|
Accession No | AB037831 |
Description | dynein, axonemal, heavy chain 1 |
Clone name | pg00933y4 |
Vector information | |
cDNA sequence | DNA sequence (13104 bp) Predicted protein sequence (4293 aa) |
Flexi ORF Clone |
FXC00827
![]() |
Source | Human brain (hippocampus) |
Note | We replaced pg00933y2 and fh06675, former representative clones for KIAA1410 with pg00933y4. (2008/8/27,2003/4/2) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 45 bp |
---|---|
Genome contig ID | gi89161205f_52225375 |
PolyA signal sequence (ATTAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (184174 - 184223) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 52325375 | 52409547 | 78 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013602 | 1039 | 1449 | PF08393 | Dynein heavy chain |
IPR011704 | 1885 | 2039 | PF07728 | ATPase associated with various cellular activities | |
IPR011704 | 2250 | 2397 | PF07728 | ATPase associated with various cellular activities | |
IPR004273 | 3582 | 4290 | PF03028 | Dynein heavy chain |
Primer_f | CTGGGGCGCAACTTTATCTTC |
---|---|
Primer_r | CCACTAGGTTCTTGAAGGCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATCGAGGTGCTGTCTGTGGTG |
Primer_r | AGATTGTCAGGCAGCTCCGTG |
PCR product length | 173(800) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |