Order Kazusa clone(s) from : ![]() |
Product ID | ORK02065 |
---|---|
Accession No | AB040936 |
Description | dynein, axonemal, heavy chain 2, transcript variant 1 |
Clone name | hk03643y1 |
Vector information | |
cDNA sequence | DNA sequence (14955 bp) Predicted protein sequence (4464 aa) |
HaloTag ORF Clone |
FHC02065
![]() |
Flexi ORF Clone | FXC02065 |
Source | Human adult brain |
Note | We replaced hk03643, former representative clones for KIAA1503 with hk03643y1. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 211 bp |
---|---|
Genome contig ID | gi51511734f_7461397 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (216392 - 216441) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | f | 7561397 | 7677787 | 86 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013594 | 275 | 764 | PF08385 | Dynein heavy chain |
IPR013602 | 1255 | 1670 | PF08393 | Dynein heavy chain | |
IPR011704 | 2116 | 2267 | PF07728 | ATPase associated with various cellular activities | |
IPR011704 | 2448 | 2594 | PF07728 | ATPase associated with various cellular activities | |
IPR004273 | 3755 | 4461 | PF03028 | Dynein heavy chain | |
HMMSmart | IPR003593 | 1834 | 1970 | SM00382 | AAA+ ATPase |
IPR003593 | 2445 | 2592 | SM00382 | AAA+ ATPase |
![]() |
Primer_f | CTCCCTGCCTTTTCAATGTCC |
---|---|
Primer_r | TGAAGGCTCCGGGACTAAAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTCCCTGCCTTTTCAATGTCC |
Primer_r | TGAAGGCTCCGGGACTAAAGG |
PCR product length | 140 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |