KIAA1503

Product ID	ORK02065
Accession No	AB040936
Description	dynein, axonemal, heavy chain 2, transcript variant 1
Clone name	hk03643y1
Vector information	The cDNA fragment was inserted at ApaI-NotI site of the pBlu ... The cDNA fragment was inserted at ApaI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CGCCCACGCG TCCG-5' end of cDNA
cDNA sequence	DNA sequence (14955 bp) Predicted protein sequence (4464 aa)
HaloTag ORF Clone	FHC02065
Flexi ORF Clone	FXC02065
Source	Human adult brain
Note	We replaced hk03643, former representative clones for KIAA1503 with hk03643y1. (2005/08/06)

Length: 14955 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	211 bp
Genome contig ID	gi51511734f_7461397
PolyA signal sequence (None)	+--------+--------+----*----+---- GAGCTCAGTGCTGTAAAACACCCGCGACAACAAGC
Flanking genome sequence (216392 - 216441)	----+--------+--------+--------+--------+----* CTTAAGTCTCTCAATGCAATGGTGAGGGTCTGGGGAGGGAGGAAGCCCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	7561397	7677787	86	99.9	Perfect prediction

Length: 4464 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72530	100.0	dynein, axonema...	synthetic construct
Q9P225	99.9	Dynein heavy ch...	Homo sapiens
XP_001255916	92.3	similar to dyne...	Bos taurus
XP_001918411	92.3	dynein, axonema...	Equus caballus
XP_001079413	91.0	similar to dyne...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002355	0	37.2	KIAA0357
AB095937	0	39.6	KIAA2017
AB051484	1.4e-165	40.2	KIAA1697
AB046823	3.4e-127	37.2	KIAA1603
AB082528	4.1e-99	27.6	KIAA1997

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013594	275	764	PF08385	Dynein heavy chain
	IPR013602	1255	1670	PF08393	Dynein heavy chain
	IPR011704	2116	2267	PF07728	ATPase associated with various cellular activities
	IPR011704	2448	2594	PF07728	ATPase associated with various cellular activities
	IPR004273	3755	4461	PF03028	Dynein heavy chain
HMMSmart	IPR003593	1834	1970	SM00382	AAA+ ATPase
HMMSmart	IPR003593	2445	2592	SM00382	AAA+ ATPase

Primer_f	CTCCCTGCCTTTTCAATGTCC
Primer_r	TGAAGGCTCCGGGACTAAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTCCCTGCCTTTTCAATGTCC
Primer_r	TGAAGGCTCCGGGACTAAAGG
PCR product length	140 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles