Order Kazusa clone(s) from : ![]() |
Product ID | ORK00039 |
---|---|
Accession No | D87072 |
Description | lysine (K)-specific demethylase 5D, transcript variant 3 |
Clone name | ha02764 |
Vector information | |
cDNA sequence | DNA sequence (5134 bp) Predicted protein sequence (1512 aa) |
Flexi ORF Clone | FXC00039 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0234
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 575 bp |
---|---|
Genome contig ID | gi89161220r_20226694 |
PolyA signal sequence (AATAAA,-28) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003349 | 45 | 89 | PF02375 | Transcription factor jumonji |
IPR001606 | 106 | 202 | PF01388 | AT-rich interaction region | |
IPR001965 | 289 | 337 | PF00628 | Zinc finger | |
IPR013129 | 464 | 580 | PF02373 | Transcription factor jumonji | |
IPR004198 | 670 | 723 | PF02928 | Zinc finger | |
IPR013637 | 734 | 1060 | PF08429 | PLU-1-like | |
IPR001965 | 1147 | 1210 | PF00628 | Zinc finger | |
HMMSmart | IPR003349 | 43 | 84 | SM00545 | Transcription factor jumonji |
IPR001965 | 289 | 335 | SM00249 | Zinc finger | |
IPR003347 | 431 | 597 | SM00558 | Transcription factor jumonji/aspartyl beta-hydroxylase | |
IPR001965 | 1147 | 1208 | SM00249 | Zinc finger | |
ProfileScan | IPR003349 | 44 | 85 | PS51183 | Transcription factor jumonji |
IPR001965 | 287 | 337 | PS50016 | Zinc finger | |
IPR003347 | 431 | 597 | PS51184 | Transcription factor jumonji/aspartyl beta-hydroxylase | |
ScanRegExp | IPR001965 | 290 | 334 | PS01359 | Zinc finger |
IPR001965 | 1148 | 1207 | PS01359 | Zinc finger |
Panel name | CCR |
---|---|
Primer_f | ACCCCGATGCTCAGAAGTGTC |
Primer_r | TACAGAAAGAGGGTGGTGGGG |
PCR product length | 157 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |