ROUGE |
Gene/Protein Characteristic Table for mKIAA2014 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129473 |
---|---|
formin-like 3 protein. WW domain binding protein 3. |
|
mpm02193 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4326 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1156 bp Genome contig ID gi65543215r_99275031 PolyA signal sequence
(CATAAA,-22) +----*----+----*----+----*----+----
TTCCTTTCTTGTACATAAATCCCAGACCTCTCAACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAGTCTTGCACCAAGCTGTCTTCTCTTTGTCAGAGTGGCCATGAGGATA
KIAA Alignment based on: KIAA2014 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 33..3170
Length: 1045 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |