ROUGE

Gene/Protein Characteristic Table for mKIAA0666

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129185
Description :	Disheveled associated activator of morphogenesis 1.
Clone Name :	mbg21234 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5820 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2442 bp

Genome contig ID gi65532617f_68567968
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
ATGGCAATATGCAATAAAGATGACTTCACTGGGTG
Flanking genome sequence
(261840 - 261889)
----+----*----+----*----+----*----+----*----+----*
TACAGATCTGTTTTCTATGCATTATTAAAATAGCAAGGTTAAACTTCCTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0666 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0666	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 115..3378
Length: 1087 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH76585	100.0	Dishevelled ass...	Mus musculus
Q8BPM0	99.9	Disheveled-asso...	Mus musculus
XP_001497343	97.1	dishevelled ass...	Equus caballus
Q9Y4D1	97.1	Disheveled-asso...	Homo sapiens
XP_852088	96.7	similar to dish...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122266	5.6e-44	64.3	mKIAA0381
AK220466	1.6e-19	27.7	mKIAA4062
AK220493	6.8e-19	28.4	mKIAA4117
AK129473	8.3e-16	27.3	mKIAA2014
AK131173	1.1e-14	29.1	mFLJ00304

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010473 55 243 PF06371 Diaphanous GTPase-binding

IPR010472 245 451 PF06367 Diaphanous FH3

IPR003104 611 993 PF02181 Actin-binding FH2

HMMSmart IPR003104 610 1070 SM00498 Actin-binding FH2

ProfileScan IPR000694 538 603 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010473	55	243	PF06371	Diaphanous GTPase-binding
IPR010472	245	451	PF06367	Diaphanous FH3
IPR003104	611	993	PF02181	Actin-binding FH2
HMMSmart	IPR003104	610	1070	SM00498	Actin-binding FH2
ProfileScan	IPR000694	538	603	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2442 bp
Genome contig ID	gi65532617f_68567968
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATGGCAATATGCAATAAAGATGACTTCACTGGGTG
Flanking genome sequence (261840 - 261889)	----+--------+--------+--------+--------+----* TACAGATCTGTTTTCTATGCATTATTAAAATAGCAAGGTTAAACTTCCTA

Gene/Protein Characteristic Table for mKIAA0666

Features of the cloned DNA sequence

Features of the protein sequence