ROUGE

Gene/Protein Characteristic Table for mKIAA0381

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122266
Description :	Disheveled associated activator of morphogenesis 2.
Clone Name :	mbe05005 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 8963 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2504 bp

Genome contig ID gi65550231r_46886380
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
ACTTAAAAAAAAATATTAAATCCATCCCCACCCCT
Flanking genome sequence
(99970 - 99921)
----+----*----+----*----+----*----+----*----+----*
AGCCTGCCTAGAAACTTTTCTTCCCGTGTGGACTCAGGTTGTGGGCTGTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0381 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0381	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 149..1297, 1437..2165, 5239..6459
Length: 1032 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_518453	1.3e-161	85.2	dishevelled ass...	Pan troglodytes
XP_538904	1.1e-160	87.0	similar to Dish...	Canis lupus fam...
XP_864808	2.8e-160	86.9	similar to Dish...	Canis lupus fam...
XP_002186640	9.4e-138	75.8	dishevelled ass...	Taeniopygia guttata
XP_001062791	2.3e-130	86.9	similar to Dish...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129185	1e-46	64.4	mKIAA0666
AK220493	3.8e-18	27.4	mKIAA4117
AK129473	3.5e-16	27.3	mKIAA2014
AK131173	1.2e-15	29.7	mFLJ00304
AK173244	1.1e-09	28.2	mKIAA1727

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010473 55 244 PF06371 Diaphanous GTPase-binding

IPR010472 246 432 PF06367 Diaphanous FH3

IPR003104 565 934 PF02181 Actin-binding FH2

HMMSmart IPR003104 564 1002 SM00498 Actin-binding FH2

ProfileScan IPR000694 487 573 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010473	55	244	PF06371	Diaphanous GTPase-binding
IPR010472	246	432	PF06367	Diaphanous FH3
IPR003104	565	934	PF02181	Actin-binding FH2
HMMSmart	IPR003104	564	1002	SM00498	Actin-binding FH2
ProfileScan	IPR000694	487	573	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2504 bp
Genome contig ID	gi65550231r_46886380
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- ACTTAAAAAAAAATATTAAATCCATCCCCACCCCT
Flanking genome sequence (99970 - 99921)	----+--------+--------+--------+--------+----* AGCCTGCCTAGAAACTTTTCTTCCCGTGTGGACTCAGGTTGTGGGCTGTG

Gene/Protein Characteristic Table for mKIAA0381

Features of the cloned DNA sequence

Features of the protein sequence