Order Kazusa clone(s) from : ![]() |
Product ID | ORK01701 |
---|---|
Accession No | AB095934 |
Description | formin-like 3, transcript variant 1 |
Clone name | ff00951s1 |
Vector information | |
cDNA sequence | DNA sequence (11191 bp) Predicted protein sequence (1032 aa) |
HaloTag ORF Clone |
FHC01701
![]() |
Flexi ORF Clone | FXC01701 |
Source | Human fetal brain |
Rouge ID |
mKIAA2014
by Kazusa Mouse cDNA Project
|
Note | We replaced ff00951, former representative clones for KIAA2014 with ff00951s1. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 7873 bp |
---|---|
Genome contig ID | gi89161190r_48218107 |
PolyA signal sequence (AGTAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99884 - 99835) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | r | 48317991 | 48387464 | 26 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR010473 | 31 | 284 | PF06371 | Diaphanous GTPase-binding |
IPR010472 | 286 | 487 | PF06367 | Diaphanous FH3 | |
IPR015425 | 567 | 931 | PF02181 | Actin-binding FH2 | |
HMMSmart | IPR003104 | 566 | 1000 | SM00498 | Actin-binding FH2 and DRF autoregulatory |
ProfileScan | IPR014768 | 31 | 477 | PS51232 | GTPase-binding/formin homology 3 |
![]() |
Primer_f | AGGAACTAGAGAGCATCAAGG |
---|---|
Primer_r | TGGCTCCAAATGACATCGACG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |