Gene/Protein Characteristic Table for KIAA2014
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01701
Accession No AB095934
Description formin-like 3
Clone name ff00951s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
ORF sequence DNA sequence (11191 bp)
Protein sequence (1032 aa)
Flexi ORF Clone FXC01701
Source Human fetal brain
Rouge ID mKIAA2014 by Kazusa Mouse cDNA Project
Note We replaced ff00951, former representative clones for KIAA2014 with ff00951s1. (2005/08/06)
Features of the cloned cDNA sequence
Description

Length: 11191 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 7873 bp
Genome contig ID gi89161190r_48218107
PolyA signal sequence
(AGTAAA,-18)
+----*----+----*----+----*----+----
CTGTATCCCTAGTGTGCAGTAAAGGATCACAGTAG
Flanking genome sequence
(99884 - 99835)
----+----*----+----*----+----*----+----*----+----*
ATATCTGCTGAACCAAGCTGTAATGCTTCTGCAAAACAGGACTTATCAGG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 12 r 48317991 48387464 26 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 1032 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI59101 0 100.0 Formin-like 3 [...
Homo sapiens
XP_591526 0 97.9 similar to form...
Bos taurus
Q8IVF7 0 98.8 Formin-like pro...
Homo sapiens
EAW58086 0 98.6 formin-like 3, ...
Homo sapiens
XP_543681 0 97.5 similar to form...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB067489 5.5e-56 69.8 KIAA1902
AB002379 5e-17 27.0 KIAA0381
AB014566 3.1e-16 26.9 KIAA0666
AB051514 1.9e-10 28.7 KIAA1727
AB051482 4.5e-05 21.7 KIAA1695
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR010473 31 284 PF06371 Diaphanous GTPase-binding
IPR010472 286 487 PF06367 Diaphanous FH3
IPR015425 567 931 PF02181 Actin-binding FH2
HMMSmart IPR003104 566 1000 SM00498 Actin-binding FH2 and DRF autoregulatory
ProfileScan IPR014768 31 477 PS51232 GTPase-binding/formin homology 3
Expression profile
Description

RT-PCR-ELISA

RH mapping information
Description

Chromosome No. 12
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp