KIAA2014

Product ID	ORK01701
Accession No	AB095934
Description	formin-like 3, transcript variant 1
Clone name	ff00951s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (11191 bp) Predicted protein sequence (1032 aa)
HaloTag ORF Clone	FHC01701
Flexi ORF Clone	FXC01701
Source	Human fetal brain
Rouge ID	mKIAA2014 by Kazusa Mouse cDNA Project
Note	We replaced ff00951, former representative clones for KIAA2014 with ff00951s1. (2005/08/06)

Length: 11191 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	7873 bp
Genome contig ID	gi89161190r_48218107
PolyA signal sequence (AGTAAA,-18)	+--------+--------+----*----+---- CTGTATCCCTAGTGTGCAGTAAAGGATCACAGTAG
Flanking genome sequence (99884 - 99835)	----+--------+--------+--------+--------+----* ATATCTGCTGAACCAAGCTGTAATGCTTCTGCAAAACAGGACTTATCAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	48317991	48387464	26	99.3	Perfect prediction

Length: 1032 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI59101	100.0	Formin-like 3 [...	Homo sapiens
XP_591526	97.9	similar to form...	Bos taurus
Q8IVF7	98.8	Formin-like pro...	Homo sapiens
EAW58086	98.6	formin-like 3, ...	Homo sapiens
XP_543681	97.5	similar to form...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067489	5.5e-56	69.8	KIAA1902
AB002379	5e-17	27.0	KIAA0381
AB014566	3.1e-16	26.9	KIAA0666
AB051514	1.9e-10	28.7	KIAA1727
AB051482	4.5e-05	21.7	KIAA1695

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010473	31	284	PF06371	Diaphanous GTPase-binding
	IPR010472	286	487	PF06367	Diaphanous FH3
	IPR015425	567	931	PF02181	Actin-binding FH2
HMMSmart	IPR003104	566	1000	SM00498	Actin-binding FH2 and DRF autoregulatory
ProfileScan	IPR014768	31	477	PS51232	GTPase-binding/formin homology 3

Primer_f	AGGAACTAGAGAGCATCAAGG
Primer_r	TGGCTCCAAATGACATCGACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-