ROUGE

Gene/Protein Characteristic Table for mFLJ00304

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131173
Description :	lymphocyte specific formin related protein. formin-related gene in leukocytes. formin-like.
Clone Name :	mng15233 [Vector Info]
Source :	Mouse NKT cells

Features of the cloned DNA sequence	Description

Length: 2910 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 314 bp

Genome contig ID gi65527427f_102907497
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTTTTATACAAGATTAATAAAGATGTTTGCAAAAG
Flanking genome sequence
(112495 - 112544)
----+----*----+----*----+----*----+----*----+----*
ACGTGCGTCGGCTCGGTGCCTGATCCCACTAGGCGCAGCCAGTTTCGCTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00304 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00304	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2596
Length: 864 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21423	6e-216	100.0	mFLJ00304 prote...	Mus musculus
Q9JL26	6.9e-216	100.0	Formin-like pro...	Mus musculus
CAM21567	3.9e-208	98.7	formin-like 1 [...	Mus musculus
AAD01273	3.6e-207	98.3	lymphocyte spec...	Mus musculus
EDM06259	1.7e-192	96.4	formin-like 1 (...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129473	4e-34	55.7	mKIAA2014
AK173293	4.1e-16	57.7	mKIAA1902
AK220493	3e-15	27.2	mKIAA4117
AK129185	6.2e-13	29.1	mKIAA0666
AK122266	6.9e-13	29.2	mKIAA0381

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010472 53 262 PF06367 Diaphanous FH3

IPR003104 398 763 PF02181 Actin-binding FH2

HMMSmart IPR003104 397 827 SM00498 Actin-binding FH2

ProfileScan IPR000694 302 381 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010472	53	262	PF06367	Diaphanous FH3
IPR003104	398	763	PF02181	Actin-binding FH2
HMMSmart	IPR003104	397	827	SM00498	Actin-binding FH2
ProfileScan	IPR000694	302	381	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	314 bp
Genome contig ID	gi65527427f_102907497
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTTTATACAAGATTAATAAAGATGTTTGCAAAAG
Flanking genome sequence (112495 - 112544)	----+--------+--------+--------+--------+----* ACGTGCGTCGGCTCGGTGCCTGATCCCACTAGGCGCAGCCAGTTTCGCTC

Gene/Protein Characteristic Table for mFLJ00304

Features of the cloned DNA sequence

Features of the protein sequence