ROUGE

Gene/Protein Characteristic Table for mKIAA4191

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220233
Description :
Clone Name :	msh25333 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 3795 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 999 bp

Genome contig ID gi65543215r_88640184
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CATTTTTATATTAAAAATAAAGTGAAGATTTGGAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTGTGGCCCTCTCATTCCTGCATCACTAGGAGGCTGGGTGAGCTGTAGC

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 1..2793
Length: 931 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001028446	100.0	bromodomain con...	Mus musculus
XP_001139344	94.5	bromodomain con...	Pan troglodytes
EAW73473	94.5	bromodomain con...	Homo sapiens
AAH47508	94.4	BRD1 protein [H...	Homo sapiens
XP_848502	93.1	similar to brom...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129322	3.9e-44	48.8	mKIAA1286
AK129091	6.1e-10	33.2	mKIAA0215
AK220504	1.6e-09	36.0	mKIAA4140
AK129445	9.8e-09	25.7	mKIAA1807
AK129097	1.6e-08	31.9	mKIAA0239

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001487 338 354 PR00503 Bromodomain

IPR001487 354 372 PR00503 Bromodomain

IPR001487 372 391 PR00503 Bromodomain

HMMPfam IPR001487 309 396 PF00439 Bromodomain

IPR000313 799 899 PF00855 PWWP

HMMSmart IPR001965 68 131 SM00249 Zinc finger

IPR001487 302 410 SM00297 Bromodomain

IPR000313 800 883 SM00293 PWWP

ProfileScan IPR001487 321 391 PS50014 Bromodomain

IPR000313 802 885 PS50812 PWWP

ScanRegExp IPR001487 326 383 PS00633 Bromodomain

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	338	354	PR00503	Bromodomain
IPR001487	354	372	PR00503	Bromodomain
IPR001487	372	391	PR00503	Bromodomain
HMMPfam	IPR001487	309	396	PF00439	Bromodomain
IPR000313	799	899	PF00855	PWWP
HMMSmart	IPR001965	68	131	SM00249	Zinc finger
IPR001487	302	410	SM00297	Bromodomain
IPR000313	800	883	SM00293	PWWP
ProfileScan	IPR001487	321	391	PS50014	Bromodomain
IPR000313	802	885	PS50812	PWWP
ScanRegExp	IPR001487	326	383	PS00633	Bromodomain

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	999 bp
Genome contig ID	gi65543215r_88640184
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CATTTTTATATTAAAAATAAAGTGAAGATTTGGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGTGGCCCTCTCATTCCTGCATCACTAGGAGGCTGGGTGAGCTGTAGC

Gene/Protein Characteristic Table for mKIAA4191

Features of the cloned DNA sequence

Features of the protein sequence