Gene/Protein Characteristic Table for mKIAA0876

Length: 4360 bp

Restriction map

Length of 3'UTR	1131 bp
Genome contig ID	gi65550231f_53863133
PolyA signal sequence (ATTAAA,-28)	+----*----+----*----+----*----+---- AGTATCAATTAAAGCCCGTGAGCTGAGCGCTTCCT
Flanking genome sequence (176770 - 176819)	----+----*----+----*----+----*----+----*----+----* ATTCCCACCTGGTCATGGCTGTGTCTTCATTTCTGGCCAGGACAAGATCG

KIAA	Alignment based on:
KIAA0876	DNA sequence, AA sequence

Coding region: 146..3229

Length: 1027 aa

Entry Exp ID% Protein Source EDL38165 0 99.9 jumonji domain ... Mus musculus CAQ12194 0 99.9 jumonji domain ... Mus musculus Q91VY5 0 94.0 JmjC domain-con... Mus musculus BAE24866 0 93.9 unnamed protein... Mus musculus XP_584880 6.2e-215 74.6 similar to jumo... Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129187 4.8e-78 48.1 mKIAA0677 AK173023 4.1e-50 51.8 mKIAA0780 AK129096 4.9e-07 33.5 mKIAA0234 AK220451 6.2e-07 35.0 mKIAA4034 AK129097 5.7e-06 37.3 mKIAA0239

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003349	20	67	PF02375	Transcription factor jumonji
	IPR003347	182	298	PF02373	Transcription factor jumonji
HMMSmart	IPR003349	20	62	SM00545	Transcription factor jumonji
	IPR001965	718	776	SM00249	Zinc finger
	IPR001965	838	894	SM00249	Zinc finger
	IPR002999	904	960	SM00333	Tudor
ProfileScan	IPR000694	487	556	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-