Gene/Protein Characteristic Table for mKIAA0677

Length: 4516 bp

Restriction map

Length of 3'UTR	1271 bp
Genome contig ID	gi65493515r_116995865
PolyA signal sequence (AATAAA,-19)	+----*----+----*----+----*----+---- TTACCTTGTCCTTAGCAATAAAATGGATTGAACAG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AGGATTGACTGTGGTCTGCCCCATGAGCCCAAGTGGCCCTGGGTCAGGCT

KIAA	Alignment based on:
KIAA0677	DNA sequence, AA sequence, Physical map

Coding region: 3..3245

Length: 1080 aa

Entry Exp ID% Protein Source Q8BW72 0 100.0 JmjC domain-con... Mus musculus CAM27385 0 99.9 jumonji domain ... Mus musculus BAE26776 0 99.8 unnamed protein... Mus musculus BAC35653 0 99.9 unnamed protein... Mus musculus O75164 0 93.7 JmjC domain-con... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129233 2.8e-146 48.2 mKIAA0876 AK173023 3.7e-91 53.8 mKIAA0780 AK129096 1.9e-16 33.6 mKIAA0234 AK220451 3.8e-16 35.3 mKIAA4034 AK129097 1.3e-12 41.3 mKIAA0239

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003349	29	76	PF02375	Transcription factor jumonji
	IPR003347	191	307	PF02373	Transcription factor jumonji
HMMSmart	IPR003349	29	71	SM00545	Transcription factor jumonji
	IPR001965	725	783	SM00249	Zinc finger
	IPR001965	845	901	SM00249	Zinc finger
	IPR002999	913	970	SM00333	Tudor
	IPR002999	971	1027	SM00333	Tudor
ProfileScan	NULL	518	548	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-