ROUGE |
Gene/Protein Characteristic Table for mKIAA0359 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122258 |
---|---|
Kinesin-like protein KIF3B. | |
mbg06791 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5583 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3225 bp Genome contig ID gi66880554f_152648392 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
TAAAATGTGTAATAAAAATCAATCAAATTTATTGTFlanking genome sequence
(141928 - 141977) ----+----*----+----*----+----*----+----*----+----*
ATCTACAAAGAGGTGTCCTTGTCAGTGATTGGTGCCTTTTCGAATGATTT
KIAA Alignment based on: KIAA0359 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 85..2358
Length: 757 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |