Gene/Protein Characteristic Table for mKIAA4086

Length: 6295 bp

Restriction map

Length of 3'UTR	2759 bp
Genome contig ID	gi65524842r_126861648
PolyA signal sequence (AATAAA,-21)	+----*----+----*----+----*----+---- ACAAATATCTTTAAAATAAAATAACTTCGATGACG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* ACTTGCTGTTGCTTCTTATTCATTTTTCAAAGGGCTTTTGTTTGCCTTTT

Coding region: 60..3533

Length: 1158 aa

Entry Exp ID% Protein Source P33175 0 99.9 Kinesin heavy c... Mus musculus AAC79803 0 99.5 kinesin heavy c... Mus musculus Q6QLM7 0 98.3 Kinesin heavy c... Rattus norvegicus BAE06127 0 97.0 KIF5A variant p... Homo sapiens Q12840 0 97.6 Kinesin heavy c... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AB093244 2.4e-127 74.8 mKIAA0531 AK122258 1.2e-22 35.7 mKIAA0359 AF090190 8.3e-12 27.8 mKIAA0591 AK173007 4.2e-11 32.7 mKIAA0706 AK220283 1.3e-07 31.3 mKIAA4058

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	208	229	PR00380	Kinesin
	IPR001752	327	344	PR00380	Kinesin
	IPR001752	358	376	PR00380	Kinesin
	IPR001752	408	429	PR00380	Kinesin
HMMPfam	IPR001752	146	459	PF00225	Kinesin
HMMSmart	IPR001752	138	466	SM00129	Kinesin
ProfileScan	IPR001752	137	388	PS50067	Kinesin
ScanRegExp	IPR001752	357	368	PS00411	Kinesin

Method	From	To	amino acid sequence
-	-	-	-