Gene/Protein Characteristic Table for mKIAA0531

Length: 6731 bp

Restriction map

Length of 3'UTR	3619 bp
Genome contig ID	gi66880554f_49451584
PolyA signal sequence (AATAAA,-22)	+----*----+----*----+----*----+---- CTCAAAACTGGACAATAAAACTGAGTTAAACTTTG
Flanking genome sequence (255358 - 255407)	----+----*----+----*----+----*----+----*----+----* ACTGGTCTGGTGTCCTTATTTGAGCCCCAGCAGGGTATCTTGACAAGAAG

KIAA	Alignment based on:
KIAA0531	DNA sequence, AA sequence, Physical map

Coding region: 149..3112

Length: 987 aa

Entry Exp ID% Protein Source AAH67051 0 100.0 Kinesin family ... Mus musculus BAE34712 0 99.9 unnamed protein... Mus musculus P28738 0 99.8 Kinesin heavy c... Mus musculus EDM00464 0 99.5 kinesin family ... Rattus norvegicus O60282 0 98.2 Kinesin heavy c... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220479 4.8e-128 74.8 mKIAA4086 AK122258 1.6e-21 35.6 mKIAA0359 AF090190 1e-12 28.9 mKIAA0591 AK173007 1.2e-11 26.3 mKIAA0706 AK220283 5.2e-07 31.1 mKIAA4058

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	108	129	PR00380	Kinesin
	IPR001752	227	244	PR00380	Kinesin
	IPR001752	258	276	PR00380	Kinesin
	IPR001752	308	329	PR00380	Kinesin
HMMPfam	IPR001752	45	359	PF00225	Kinesin
HMMSmart	IPR001752	37	366	SM00129	Kinesin
ProfileScan	IPR001752	36	288	PS50067	Kinesin
ScanRegExp	IPR001752	257	268	PS00411	Kinesin

Method	From	To	amino acid sequence
-	-	-	-