KIAA0359

Product ID	ORK00515
Accession No	AB002357
Description	kinesin family member 3B
Clone name	hh00048
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hh00048 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4724 bp) Predicted protein sequence (760 aa)
HaloTag ORF Clone	FHC00515
Flexi ORF Clone	FXC00515
Source	Human adult brain
Rouge ID	mKIAA0359 by Kazusa Mouse cDNA Project

Length: 4724 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2313 bp
Genome contig ID	gi51511747f_30261175
PolyA signal sequence (None)	+--------+--------+----*----+---- ATTCCAGCCTGGGTGACAGAGTGAGACTCCACCTC
Flanking genome sequence (123923 - 123972)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAACAGAAAGAAAGAAAAAGAAAACTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	30329128	30385096	9	99.5	Perfect prediction

Length: 760 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15066	100.0	Kinesin-like pr...	Homo sapiens
XP_001108420	99.9	kinesin family ...	Macaca mulatta
XP_001500239	99.5	similar to Kine...	Equus caballus
EDL06022	98.1	kinesin family ...	Mus musculus
EDL86006	97.9	kinesin family ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037826	8.9e-32	40.0	KIAA1405
AB014606	2.5e-21	40.4	KIAA0706
AB011103	1e-20	34.7	KIAA0531
AB040881	4.2e-20	43.5	KIAA1448
AB014539	1.5e-19	45.7	KIAA0639

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	100	121	PR00380	Kinesin
	IPR001752	219	236	PR00380	Kinesin
	IPR001752	253	271	PR00380	Kinesin
	IPR001752	303	324	PR00380	Kinesin
HMMPfam	IPR001752	28	354	PF00225	Kinesin
HMMSmart	IPR001752	20	361	SM00129	Kinesin
ProfileScan	IPR001752	19	283	PS50067	Kinesin
ScanRegExp	IPR001752	252	263	PS00411	Kinesin

Primer_f	TGAGGAAATGTGGTGTGAGAG
Primer_r	AGAACAAAACGCTAAGGTGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGAGGAAATGTGGTGTGAGAG
Primer_r	AGAACAAAACGCTAAGGTGGG
PCR product length	76 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles