Order Kazusa clone(s) from : ![]() |
Product ID | ORK00515 |
---|---|
Accession No | AB002357 |
Description | kinesin family member 3B |
Clone name | hh00048 |
Vector information | |
cDNA sequence | DNA sequence (4724 bp) Predicted protein sequence (760 aa) |
HaloTag ORF Clone |
FHC00515
![]() |
Flexi ORF Clone | FXC00515 |
Source | Human adult brain |
Rouge ID |
mKIAA0359
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2313 bp |
---|---|
Genome contig ID | gi51511747f_30261175 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (123923 - 123972) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | f | 30329128 | 30385096 | 9 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001752 | 100 | 121 | PR00380 | Kinesin |
IPR001752 | 219 | 236 | PR00380 | Kinesin | |
IPR001752 | 253 | 271 | PR00380 | Kinesin | |
IPR001752 | 303 | 324 | PR00380 | Kinesin | |
HMMPfam | IPR001752 | 28 | 354 | PF00225 | Kinesin |
HMMSmart | IPR001752 | 20 | 361 | SM00129 | Kinesin |
ProfileScan | IPR001752 | 19 | 283 | PS50067 | Kinesin |
ScanRegExp | IPR001752 | 252 | 263 | PS00411 | Kinesin |
![]() |
---|
Primer_f | TGAGGAAATGTGGTGTGAGAG |
---|---|
Primer_r | AGAACAAAACGCTAAGGTGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGAGGAAATGTGGTGTGAGAG |
Primer_r | AGAACAAAACGCTAAGGTGGG |
PCR product length | 76 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |