| ROUGE |
Gene/Protein Characteristic Table for mKIAA0706 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK173007 |
|---|---|
| Kinesin-like protein KIF1C (Fragment). | |
| mfj19350 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4962 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1546 bp Genome contig ID gi65527427f_70326320 PolyA signal sequence
(AATAAA,-20)
AAAAAAAAAATCAATAATAAAAATTCAGAAAATTCFlanking genome sequence
(129765 - 129814)
GCTGCCTTTGTCTTTAACTCTAGTTTGAGTAGCACGCTTAGGGATGCCAC
KIAA Alignment based on: KIAA0706 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 54..3416
Length: 1120 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage 
| |
