ROUGE |
Gene/Protein Characteristic Table for mKIAA0327 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220461 |
---|---|
mfj34062 [Vector Info] | |
Source : | Mouse fetal brain |
Note : | This cDNA was previously called as mKIAA4054. |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4682 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1743 bp Genome contig ID gi65551972f_37849476 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TTCGAAAATTAAAAATAAAAAAATGGTTTCTTCTGFlanking genome sequence
(216122 - 216171) ----+----*----+----*----+----*----+----*----+----*
AAAGTGTGACCGCGTCTGTTTAAGAGATGGAACACAGAACATGTGGGTGG
KIAA Alignment based on: KIAA0327 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 138..2939
Length: 933 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |