ROUGE |
Gene/Protein Characteristic Table for mKIAA1621 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122533 |
---|---|
protocadherin beta 17. | |
mbg08078 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4661 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1897 bp Genome contig ID gi65551972f_37608518 PolyA signal sequence
(ATTAAA,-26) +----*----+----*----+----*----+----
GCAAGGGAGATTAAAGTGAGTCTGCGCTAGAAGTCFlanking genome sequence
(104661 - 104710) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGAGCAAAATTCTGACCGATGAGGGGGAAAGCTGAG
KIAA Alignment based on: KIAA1621 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 332..2764
Length: 810 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002126 | 84 | 103 | PR00205 | Cadherin |
IPR002126 | 253 | 282 | PR00205 | Cadherin | |
IPR002126 | 325 | 337 | PR00205 | Cadherin | |
IPR002126 | 337 | 356 | PR00205 | Cadherin | |
IPR002126 | 460 | 473 | PR00205 | Cadherin | |
IPR002126 | 520 | 546 | PR00205 | Cadherin | |
IPR002126 | 554 | 571 | PR00205 | Cadherin | |
HMMPfam | NULL | 40 | 123 | PF08266 | NULL |
IPR002126 | 149 | 244 | PF00028 | Cadherin | |
IPR002126 | 258 | 349 | PF00028 | Cadherin | |
IPR002126 | 363 | 453 | PF00028 | Cadherin | |
IPR002126 | 467 | 563 | PF00028 | Cadherin | |
IPR002126 | 579 | 674 | PF00028 | Cadherin | |
HMMSmart | IPR002126 | 166 | 251 | SM00112 | Cadherin |
IPR002126 | 275 | 356 | SM00112 | Cadherin | |
IPR002126 | 379 | 460 | SM00112 | Cadherin | |
IPR002126 | 484 | 570 | SM00112 | Cadherin | |
IPR002126 | 600 | 681 | SM00112 | Cadherin | |
ProfileScan | IPR002126 | 45 | 144 | PS50268 | Cadherin |
IPR002126 | 145 | 253 | PS50268 | Cadherin | |
IPR002126 | 254 | 358 | PS50268 | Cadherin | |
IPR002126 | 359 | 462 | PS50268 | Cadherin | |
IPR002126 | 463 | 572 | PS50268 | Cadherin | |
IPR002126 | 587 | 687 | PS50268 | Cadherin | |
ScanRegExp | IPR002126 | 241 | 251 | PS00232 | Cadherin |
IPR002126 | 346 | 356 | PS00232 | Cadherin | |
IPR002126 | 450 | 460 | PS00232 | Cadherin | |
IPR002126 | 560 | 570 | PS00232 | Cadherin |
Method | From | To | amino acid sequence |
---|---|---|---|
SOSUI | 23 | 45 | RQVLAFFVLLHVSGAGAELGPYS |
701 | 723 | YLVIALASVSSLFLLSVLLFVGV |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |