Gene/Protein Characteristic Table for mKIAA1621

Length: 4661 bp

Restriction map

Length of 3'UTR	1897 bp
Genome contig ID	gi65551972f_37608518
PolyA signal sequence (ATTAAA,-26)	+----*----+----*----+----*----+---- GCAAGGGAGATTAAAGTGAGTCTGCGCTAGAAGTC
Flanking genome sequence (104661 - 104710)	----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAGAGCAAAATTCTGACCGATGAGGGGGAAAGCTGAG

KIAA	Alignment based on:
KIAA1621	DNA sequence, AA sequence, Physical map

Coding region: 332..2764

Length: 810 aa

Entry Exp ID% Protein Source AAK26067 0 99.9 protocadherin b... Mus musculus AAK53235 0 99.6 protocadherin-b... Mus musculus EDL76355 0 90.9 rCG49511 [Rattu... Rattus norvegicus XP_001504126 0 77.3 similar to prot... Equus caballus XP_001091535 0 76.6 protocadherin b... Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220461 3.2e-125 44.5 mKIAA0327 AK129120 6.5e-116 41.3 mKIAA0345 AK122492 5.3e-66 36.3 mKIAA1313 AK173204 1.1e-45 36.0 mKIAA1562 AK122503 2.5e-33 39.7 mKIAA1400

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	84	103	PR00205	Cadherin
	IPR002126	253	282	PR00205	Cadherin
	IPR002126	325	337	PR00205	Cadherin
	IPR002126	337	356	PR00205	Cadherin
	IPR002126	460	473	PR00205	Cadherin
	IPR002126	520	546	PR00205	Cadherin
	IPR002126	554	571	PR00205	Cadherin
HMMPfam	NULL	40	123	PF08266	NULL
	IPR002126	149	244	PF00028	Cadherin
	IPR002126	258	349	PF00028	Cadherin
	IPR002126	363	453	PF00028	Cadherin
	IPR002126	467	563	PF00028	Cadherin
	IPR002126	579	674	PF00028	Cadherin
HMMSmart	IPR002126	166	251	SM00112	Cadherin
	IPR002126	275	356	SM00112	Cadherin
	IPR002126	379	460	SM00112	Cadherin
	IPR002126	484	570	SM00112	Cadherin
	IPR002126	600	681	SM00112	Cadherin
ProfileScan	IPR002126	45	144	PS50268	Cadherin
	IPR002126	145	253	PS50268	Cadherin
	IPR002126	254	358	PS50268	Cadherin
	IPR002126	359	462	PS50268	Cadherin
	IPR002126	463	572	PS50268	Cadherin
	IPR002126	587	687	PS50268	Cadherin
ScanRegExp	IPR002126	241	251	PS00232	Cadherin
	IPR002126	346	356	PS00232	Cadherin
	IPR002126	450	460	PS00232	Cadherin
	IPR002126	560	570	PS00232	Cadherin

Method	From	To	amino acid sequence
SOSUI	23	45	RQVLAFFVLLHVSGAGAELGPYS
	701	723	YLVIALASVSSLFLLSVLLFVGV