ROUGE

Gene/Protein Characteristic Table for mKIAA0345

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129120
Description :	protocadherin alpha 3.
Clone Name :	mbg19517 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4568 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1637 bp

Genome contig ID gi65551972f_37069828
PolyA signal sequence
(AGTAAA,-22)
+----*----+----*----+----*----+----
GTATGAAAGACACAGTAAAATTTCTTTCTTAAATC
Flanking genome sequence
(340788 - 340837)
----+----*----+----*----+----*----+----*----+----*
AAGATGCTGGTGATTCAAGGAATTTTATTTATGGTCAGCCAAGGGCTGTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0345 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0345	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 43..2931
Length: 962 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAK26050	99.9	protocadherin a...	Mus musculus
BAD06368	95.0	cadherin-relate...	Rattus norvegicus
Q9Y5H8	85.4	Protocadherin a...	Homo sapiens
NP_001076055	85.2	protocadherin a...	Pan troglodytes
Q5DRE9	85.1	Protocadherin a...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122533	1.7e-92	41.3	mKIAA1621
AK220461	2.9e-92	39.2	mKIAA0327
AK173204	5.8e-73	35.5	mKIAA1562
AK122503	1.3e-61	41.0	mKIAA1400
AK122492	1.7e-57	37.5	mKIAA1313

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002126 90 109 PR00205 Cadherin

IPR002126 259 288 PR00205 Cadherin

IPR002126 437 449 PR00205 Cadherin

IPR002126 451 470 PR00205 Cadherin

IPR002126 470 483 PR00205 Cadherin

IPR002126 530 556 PR00205 Cadherin

IPR002126 564 581 PR00205 Cadherin

HMMPfam NULL 46 129 PF08266 NULL

IPR002126 155 250 PF00028 Cadherin

IPR002126 264 358 PF00028 Cadherin

IPR002126 372 463 PF00028 Cadherin

IPR002126 477 573 PF00028 Cadherin

IPR002126 585 684 PF00028 Cadherin

HMMSmart IPR002126 62 148 SM00112 Cadherin

IPR002126 172 257 SM00112 Cadherin

IPR002126 281 365 SM00112 Cadherin

IPR002126 389 470 SM00112 Cadherin

IPR002126 494 580 SM00112 Cadherin

IPR002126 608 690 SM00112 Cadherin

ProfileScan IPR002126 51 150 PS50268 Cadherin

IPR002126 151 259 PS50268 Cadherin

IPR002126 260 367 PS50268 Cadherin

IPR002126 368 472 PS50268 Cadherin

IPR002126 473 582 PS50268 Cadherin

IPR002126 595 695 PS50268 Cadherin

NULL 930 952 PS50318 NULL

ScanRegExp IPR002126 138 148 PS00232 Cadherin

IPR002126 247 257 PS00232 Cadherin

IPR002126 355 365 PS00232 Cadherin

IPR002126 460 470 PS00232 Cadherin

IPR002126 570 580 PS00232 Cadherin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	90	109	PR00205	Cadherin
IPR002126	259	288	PR00205	Cadherin
IPR002126	437	449	PR00205	Cadherin
IPR002126	451	470	PR00205	Cadherin
IPR002126	470	483	PR00205	Cadherin
IPR002126	530	556	PR00205	Cadherin
IPR002126	564	581	PR00205	Cadherin
HMMPfam	NULL	46	129	PF08266	NULL
IPR002126	155	250	PF00028	Cadherin
IPR002126	264	358	PF00028	Cadherin
IPR002126	372	463	PF00028	Cadherin
IPR002126	477	573	PF00028	Cadherin
IPR002126	585	684	PF00028	Cadherin
HMMSmart	IPR002126	62	148	SM00112	Cadherin
IPR002126	172	257	SM00112	Cadherin
IPR002126	281	365	SM00112	Cadherin
IPR002126	389	470	SM00112	Cadherin
IPR002126	494	580	SM00112	Cadherin
IPR002126	608	690	SM00112	Cadherin
ProfileScan	IPR002126	51	150	PS50268	Cadherin
IPR002126	151	259	PS50268	Cadherin
IPR002126	260	367	PS50268	Cadherin
IPR002126	368	472	PS50268	Cadherin
IPR002126	473	582	PS50268	Cadherin
IPR002126	595	695	PS50268	Cadherin
NULL	930	952	PS50318	NULL
ScanRegExp	IPR002126	138	148	PS00232	Cadherin
IPR002126	247	257	PS00232	Cadherin
IPR002126	355	365	PS00232	Cadherin
IPR002126	460	470	PS00232	Cadherin
IPR002126	570	580	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 28 46 DRHLLLWLLLFAAWEAGSG

712 734 VYLIIAICAVSSLLVLTLLLYLA

Method	From	To	amino acid sequence
SOSUI	28	46	DRHLLLWLLLFAAWEAGSG
712	734	VYLIIAICAVSSLLVLTLLLYLA

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1637 bp
Genome contig ID	gi65551972f_37069828
PolyA signal sequence (AGTAAA,-22)	+--------+--------+----*----+---- GTATGAAAGACACAGTAAAATTTCTTTCTTAAATC
Flanking genome sequence (340788 - 340837)	----+--------+--------+--------+--------+----* AAGATGCTGGTGATTCAAGGAATTTTATTTATGGTCAGCCAAGGGCTGTC

Gene/Protein Characteristic Table for mKIAA0345

Features of the cloned DNA sequence

Features of the protein sequence