ROUGE

Gene/Protein Characteristic Table for mKIAA1400

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122503
Description :	protocadherin 10. OL-protocadherin.
Clone Name :	mbh01141 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4554 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 607 bp

Genome contig ID gi65492966f_44737305
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
AAGCTTCTAAATAAATATAAAATATATATTATATT
Flanking genome sequence
(141606 - 141655)
----+----*----+----*----+----*----+----*----+----*
ATATAATTTTCCTAAGATGTGATACAAATTAGTTGGTTTTTAAATGGATT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1400 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1400	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 651..3947
Length: 1098 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAK57195	100.0	OL-protocadheri...	Mus musculus
NP_001091642	100.0	protocadherin 1...	Mus musculus
NP_001091640	100.0	protocadherin 1...	Mus musculus
EDL35181	99.3	protocadherin 1...	Mus musculus
EDL35180	99.3	protocadherin 1...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122492	3.3e-70	40.2	mKIAA1313
AK173204	1.3e-63	39.0	mKIAA1562
AK220461	4.8e-61	38.0	mKIAA0327
AK129120	6e-58	41.0	mKIAA0345
AK122533	1.6e-24	39.6	mKIAA1621

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002126 120 139 PR00205 Cadherin

IPR002126 308 337 PR00205 Cadherin

IPR002126 486 498 PR00205 Cadherin

IPR002126 500 519 PR00205 Cadherin

IPR002126 519 532 PR00205 Cadherin

IPR002126 579 605 PR00205 Cadherin

IPR002126 614 631 PR00205 Cadherin

HMMPfam NULL 76 159 PF08266 NULL

IPR002126 185 299 PF00028 Cadherin

IPR002126 313 407 PF00028 Cadherin

IPR002126 421 512 PF00028 Cadherin

IPR002126 526 623 PF00028 Cadherin

IPR002126 645 737 PF00028 Cadherin

HMMSmart IPR002126 92 178 SM00112 Cadherin

IPR002126 202 306 SM00112 Cadherin

IPR002126 330 414 SM00112 Cadherin

IPR002126 438 519 SM00112 Cadherin

IPR002126 543 630 SM00112 Cadherin

IPR002126 661 744 SM00112 Cadherin

ProfileScan IPR002126 74 180 PS50268 Cadherin

IPR002126 181 308 PS50268 Cadherin

NULL 264 281 PS50315 NULL

IPR002126 309 416 PS50268 Cadherin

IPR002126 417 521 PS50268 Cadherin

IPR002126 522 632 PS50268 Cadherin

IPR002126 648 738 PS50268 Cadherin

NULL 809 829 PS50311 NULL

ScanRegExp IPR002126 168 178 PS00232 Cadherin

IPR002126 296 306 PS00232 Cadherin

IPR002126 404 414 PS00232 Cadherin

IPR002126 509 519 PS00232 Cadherin

IPR002126 620 630 PS00232 Cadherin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	120	139	PR00205	Cadherin
IPR002126	308	337	PR00205	Cadherin
IPR002126	486	498	PR00205	Cadherin
IPR002126	500	519	PR00205	Cadherin
IPR002126	519	532	PR00205	Cadherin
IPR002126	579	605	PR00205	Cadherin
IPR002126	614	631	PR00205	Cadherin
HMMPfam	NULL	76	159	PF08266	NULL
IPR002126	185	299	PF00028	Cadherin
IPR002126	313	407	PF00028	Cadherin
IPR002126	421	512	PF00028	Cadherin
IPR002126	526	623	PF00028	Cadherin
IPR002126	645	737	PF00028	Cadherin
HMMSmart	IPR002126	92	178	SM00112	Cadherin
IPR002126	202	306	SM00112	Cadherin
IPR002126	330	414	SM00112	Cadherin
IPR002126	438	519	SM00112	Cadherin
IPR002126	543	630	SM00112	Cadherin
IPR002126	661	744	SM00112	Cadherin
ProfileScan	IPR002126	74	180	PS50268	Cadherin
IPR002126	181	308	PS50268	Cadherin
NULL	264	281	PS50315	NULL
IPR002126	309	416	PS50268	Cadherin
IPR002126	417	521	PS50268	Cadherin
IPR002126	522	632	PS50268	Cadherin
IPR002126	648	738	PS50268	Cadherin
NULL	809	829	PS50311	NULL
ScanRegExp	IPR002126	168	178	PS00232	Cadherin
IPR002126	296	306	PS00232	Cadherin
IPR002126	404	414	PS00232	Cadherin
IPR002126	509	519	PS00232	Cadherin
IPR002126	620	630	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 34 56 CGGGWGAVIGVAGWLQGSCFLFL

60 82 IVLLFFALLWMVDGVFSQLHYTV

773 795 TLILIIALGSVSFIFLLAMIVLA

Method	From	To	amino acid sequence
SOSUI	34	56	CGGGWGAVIGVAGWLQGSCFLFL
60	82	IVLLFFALLWMVDGVFSQLHYTV
773	795	TLILIIALGSVSFIFLLAMIVLA

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	607 bp
Genome contig ID	gi65492966f_44737305
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- AAGCTTCTAAATAAATATAAAATATATATTATATT
Flanking genome sequence (141606 - 141655)	----+--------+--------+--------+--------+----* ATATAATTTTCCTAAGATGTGATACAAATTAGTTGGTTTTTAAATGGATT

Gene/Protein Characteristic Table for mKIAA1400

Features of the cloned DNA sequence

Features of the protein sequence