HUGE

Gene/Protein Characteristic Table for KIAA1857

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00933
Accession No. :	AB058760
Description :	Netrin-G2 precursor.
HUGO Gene Name :	netrin G2 (NTNG2)
Clone Name :	fk03350 [Vector Info]
Flexi ORF Clone :	pF1KSDA1857
Source :	Human fetal brain
Note :	We replaced fh05673, former representative clones for KIAA1857 with fk03350. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 3083 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 714 bp

Genome contig ID gi89161216f_133927314
PolyA signal sequence
(AGTAAA,-16)
+----*----+----*----+----*----+----
GATGGTGGAGAATCCGAGGAGTAAAGAGTTTGCTC
Flanking genome sequence
(180720 - 180769)
----+----*----+----*----+----*----+----*----+----*
ACTGCTGCCTCCACGGCCTGTTTTCTTTCTGTGTTGGGGACGGTGGGCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 134027155 134108032 7 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 549 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96CW9	100.0	Netrin-G2; Lami...	Homo sapiens
CAI16125	99.8	netrin G2 [Homo...	Homo sapiens
XP_001105036	99.6	similar to netr...	Macaca mulatta
CAI16126	98.3	netrin G2 [Homo...	Homo sapiens
XP_001167978	97.2	netrin G2 isofo...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023193	9e-79	57.5	KIAA0976
AB067494	3.4e-21	30.0	KIAA1907
AB011542	1.2e-09	24.7	KIAA0818
AB058676	4.8e-07	29.3	KIAA1780
AB058677	1.8e-06	29.2	KIAA1781

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008211 58 304 PF00055 Laminin

IPR002049 306 363 PF00053 EGF-like

IPR002049 372 425 PF00053 EGF-like

IPR002049 428 470 PF00053 EGF-like

IPR006209 475 505 PF00008 EGF-like

HMMSmart IPR008211 52 304 SM00136 Laminin

IPR002049 306 363 SM00180 EGF-like

IPR002049 372 425 SM00180 EGF-like

IPR002049 428 470 SM00180 EGF-like

IPR006210 474 506 SM00181 EGF

ProfileScan IPR008211 54 305 PS51117 Laminin

IPR002049 306 365 PS50027 EGF-like

IPR002049 372 427 PS50027 EGF-like

IPR002049 428 472 PS50027 EGF-like

IPR000742 471 506 PS50026 EGF-like

ScanRegExp IPR013032 324 335 PS00022 EGF-like region

IPR002049 392 428 PS01248 EGF-like

IPR013032 446 457 PS00022 EGF-like region

IPR002049 446 475 PS01248 EGF-like

IPR013032 494 505 PS00022 EGF-like region

IPR013032 494 505 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008211	58	304	PF00055	Laminin
IPR002049	306	363	PF00053	EGF-like
IPR002049	372	425	PF00053	EGF-like
IPR002049	428	470	PF00053	EGF-like
IPR006209	475	505	PF00008	EGF-like
HMMSmart	IPR008211	52	304	SM00136	Laminin
IPR002049	306	363	SM00180	EGF-like
IPR002049	372	425	SM00180	EGF-like
IPR002049	428	470	SM00180	EGF-like
IPR006210	474	506	SM00181	EGF
ProfileScan	IPR008211	54	305	PS51117	Laminin
IPR002049	306	365	PS50027	EGF-like
IPR002049	372	427	PS50027	EGF-like
IPR002049	428	472	PS50027	EGF-like
IPR000742	471	506	PS50026	EGF-like
ScanRegExp	IPR013032	324	335	PS00022	EGF-like region
IPR002049	392	428	PS01248	EGF-like
IPR013032	446	457	PS00022	EGF-like region
IPR002049	446	475	PS01248	EGF-like
IPR013032	494	505	PS00022	EGF-like region
IPR013032	494	505	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGACCTGGATTGATTGGAAG

Primer_r
: ATGGACAGATCAGAAAGTTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCTGCTCTCACCTGGACTCAC
Primer_r	: TGGTCATCGTCTTCCTGGTGC
PCR product length	: 95 bp
PCR conditions	: 15 °C66 sec60 °C30 sec112 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	714 bp
Genome contig ID	gi89161216f_133927314
PolyA signal sequence (AGTAAA,-16)	+--------+--------+----*----+---- GATGGTGGAGAATCCGAGGAGTAAAGAGTTTGCTC
Flanking genome sequence (180720 - 180769)	----+--------+--------+--------+--------+----* ACTGCTGCCTCCACGGCCTGTTTTCTTTCTGTGTTGGGGACGGTGGGCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	134027155	134108032	7	99.2	Perfect prediction

Primer_f	: AAGACCTGGATTGATTGGAAG
Primer_r	: ATGGACAGATCAGAAAGTTGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1857

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information