HUGE

Gene/Protein Characteristic Table for KIAA1780

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00915
Accession No. :	AB058676
Description :	multiple EGF-like-domains 10.
HUGO Gene Name :	multiple EGF-like-domains 10 (MEGF10)
Clone Name :	pf01012 [Vector Info]
Flexi ORF Clone :	pF1KA1780
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 7522 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3896 bp

Genome contig ID gi51511721f_126554514
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
ATGAGTTTATAGATTAATGCAATAAACTTTCTAAT
Flanking genome sequence
(270295 - 270344)
----+----*----+----*----+----*----+----*----+----*
AAAAAACTCTAGTGTTTCTTTCTATATCTGATTCTACTGTTGATTAATGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 126654514 126824807 26 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1192 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB47409	100.0	MEGF10 protein ...	Homo sapiens
Q96KG7	100.0	Multiple epider...	Homo sapiens
CAH18275	99.9	hypothetical pr...	Homo sapiens
XP_517907	99.3	MEGF10 protein ...	Pan troglodytes
XP_001097941	99.1	similar to MEGF...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058677	5.1e-200	58.9	KIAA1781
AB011539	3.4e-94	42.5	KIAA0815
D63483	6.4e-37	34.0	KIAA0149
AB053450	3.8e-16	27.1	KIAA1776
D87433	3.7e-14	25.7	KIAA0246

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002049 341 359 PR00011 EGF-like

IPR002049 473 491 PR00011 EGF-like

IPR002049 819 837 PR00011 EGF-like

HMMPfam IPR011489 82 154 PF07546 EMI

IPR013111 247 273 PF07974 EGF

IPR013111 290 316 PF07974 EGF

IPR013111 333 359 PF07974 EGF

IPR002049 420 458 PF00053 EGF-like

IPR002049 594 633 PF00053 EGF-like

IPR002049 637 680 PF00053 EGF-like

IPR002049 686 710 PF00053 EGF-like

IPR013111 768 794 PF07974 EGF

IPR002049 811 854 PF00053 EGF-like

HMMSmart IPR006210 160 188 SM00181 EGF

IPR006210 199 231 SM00181 EGF

IPR002049 204 243 SM00180 EGF-like

IPR006210 242 274 SM00181 EGF

IPR002049 247 286 SM00180 EGF-like

IPR006210 285 317 SM00181 EGF

IPR006210 328 360 SM00181 EGF

IPR002049 333 372 SM00180 EGF-like

IPR006210 371 403 SM00181 EGF

IPR002049 376 416 SM00180 EGF-like

IPR006210 415 449 SM00181 EGF

IPR002049 420 461 SM00180 EGF-like

IPR006210 460 492 SM00181 EGF

IPR002049 465 504 SM00180 EGF-like

IPR006210 503 535 SM00181 EGF

IPR002049 508 547 SM00180 EGF-like

IPR006210 546 578 SM00181 EGF

IPR002049 551 590 SM00180 EGF-like

IPR006210 589 621 SM00181 EGF

IPR002049 594 633 SM00180 EGF-like

IPR006210 632 664 SM00181 EGF

IPR002049 637 680 SM00180 EGF-like

IPR006210 675 709 SM00181 EGF

IPR002049 683 721 SM00180 EGF-like

IPR006210 720 752 SM00181 EGF

IPR006210 763 795 SM00181 EGF

IPR002049 768 807 SM00180 EGF-like

IPR006210 806 838 SM00181 EGF

IPR002049 811 850 SM00180 EGF-like

IPR006210 849 881 SM00181 EGF

IPR002049 854 885 SM00180 EGF-like

ProfileScan IPR011489 82 159 PS51041 EMI

IPR000742 158 188 PS50026 EGF-like

IPR000742 196 231 PS50026 EGF-like

IPR000742 239 274 PS50026 EGF-like

IPR000742 282 317 PS50026 EGF-like

IPR000742 330 360 PS50026 EGF-like

IPR000742 368 403 PS50026 EGF-like

IPR000742 457 492 PS50026 EGF-like

IPR000742 505 535 PS50026 EGF-like

IPR000742 543 578 PS50026 EGF-like

IPR000742 591 621 PS50026 EGF-like

IPR000742 629 664 PS50026 EGF-like

IPR000742 717 752 PS50026 EGF-like

IPR000742 765 795 PS50026 EGF-like

IPR000742 803 838 PS50026 EGF-like

IPR000742 851 881 PS50026 EGF-like

ScanRegExp IPR013032 176 187 PS00022 EGF-like region

IPR013032 176 191 PS01186 EGF-like region

IPR013032 219 230 PS00022 EGF-like region

IPR013032 219 234 PS01186 EGF-like region

IPR013032 262 273 PS00022 EGF-like region

IPR013032 262 277 PS01186 EGF-like region

IPR013032 305 316 PS00022 EGF-like region

IPR013032 305 320 PS01186 EGF-like region

IPR013032 348 359 PS00022 EGF-like region

IPR013032 348 363 PS01186 EGF-like region

IPR013032 391 402 PS00022 EGF-like region

IPR013032 391 402 PS01186 EGF-like region

IPR013032 437 448 PS00022 EGF-like region

IPR013032 437 452 PS01186 EGF-like region

IPR013032 480 491 PS00022 EGF-like region

IPR013032 480 495 PS01186 EGF-like region

IPR013032 523 534 PS00022 EGF-like region

IPR013032 523 538 PS01186 EGF-like region

IPR013032 566 577 PS00022 EGF-like region

IPR013032 566 581 PS01186 EGF-like region

IPR013032 609 620 PS00022 EGF-like region

IPR013032 609 624 PS01186 EGF-like region

IPR013032 652 663 PS00022 EGF-like region

IPR013032 652 667 PS01186 EGF-like region

IPR013032 697 708 PS00022 EGF-like region

IPR013032 697 712 PS01186 EGF-like region

IPR013032 740 751 PS00022 EGF-like region

IPR013032 740 755 PS01186 EGF-like region

IPR013032 783 794 PS00022 EGF-like region

IPR013032 783 798 PS01186 EGF-like region

IPR013032 826 837 PS00022 EGF-like region

IPR013032 826 841 PS01186 EGF-like region

IPR013032 869 880 PS00022 EGF-like region

IPR013032 869 880 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002049	341	359	PR00011	EGF-like
IPR002049	473	491	PR00011	EGF-like
IPR002049	819	837	PR00011	EGF-like
HMMPfam	IPR011489	82	154	PF07546	EMI
IPR013111	247	273	PF07974	EGF
IPR013111	290	316	PF07974	EGF
IPR013111	333	359	PF07974	EGF
IPR002049	420	458	PF00053	EGF-like
IPR002049	594	633	PF00053	EGF-like
IPR002049	637	680	PF00053	EGF-like
IPR002049	686	710	PF00053	EGF-like
IPR013111	768	794	PF07974	EGF
IPR002049	811	854	PF00053	EGF-like
HMMSmart	IPR006210	160	188	SM00181	EGF
IPR006210	199	231	SM00181	EGF
IPR002049	204	243	SM00180	EGF-like
IPR006210	242	274	SM00181	EGF
IPR002049	247	286	SM00180	EGF-like
IPR006210	285	317	SM00181	EGF
IPR006210	328	360	SM00181	EGF
IPR002049	333	372	SM00180	EGF-like
IPR006210	371	403	SM00181	EGF
IPR002049	376	416	SM00180	EGF-like
IPR006210	415	449	SM00181	EGF
IPR002049	420	461	SM00180	EGF-like
IPR006210	460	492	SM00181	EGF
IPR002049	465	504	SM00180	EGF-like
IPR006210	503	535	SM00181	EGF
IPR002049	508	547	SM00180	EGF-like
IPR006210	546	578	SM00181	EGF
IPR002049	551	590	SM00180	EGF-like
IPR006210	589	621	SM00181	EGF
IPR002049	594	633	SM00180	EGF-like
IPR006210	632	664	SM00181	EGF
IPR002049	637	680	SM00180	EGF-like
IPR006210	675	709	SM00181	EGF
IPR002049	683	721	SM00180	EGF-like
IPR006210	720	752	SM00181	EGF
IPR006210	763	795	SM00181	EGF
IPR002049	768	807	SM00180	EGF-like
IPR006210	806	838	SM00181	EGF
IPR002049	811	850	SM00180	EGF-like
IPR006210	849	881	SM00181	EGF
IPR002049	854	885	SM00180	EGF-like
ProfileScan	IPR011489	82	159	PS51041	EMI
IPR000742	158	188	PS50026	EGF-like
IPR000742	196	231	PS50026	EGF-like
IPR000742	239	274	PS50026	EGF-like
IPR000742	282	317	PS50026	EGF-like
IPR000742	330	360	PS50026	EGF-like
IPR000742	368	403	PS50026	EGF-like
IPR000742	457	492	PS50026	EGF-like
IPR000742	505	535	PS50026	EGF-like
IPR000742	543	578	PS50026	EGF-like
IPR000742	591	621	PS50026	EGF-like
IPR000742	629	664	PS50026	EGF-like
IPR000742	717	752	PS50026	EGF-like
IPR000742	765	795	PS50026	EGF-like
IPR000742	803	838	PS50026	EGF-like
IPR000742	851	881	PS50026	EGF-like
ScanRegExp	IPR013032	176	187	PS00022	EGF-like region
IPR013032	176	191	PS01186	EGF-like region
IPR013032	219	230	PS00022	EGF-like region
IPR013032	219	234	PS01186	EGF-like region
IPR013032	262	273	PS00022	EGF-like region
IPR013032	262	277	PS01186	EGF-like region
IPR013032	305	316	PS00022	EGF-like region
IPR013032	305	320	PS01186	EGF-like region
IPR013032	348	359	PS00022	EGF-like region
IPR013032	348	363	PS01186	EGF-like region
IPR013032	391	402	PS00022	EGF-like region
IPR013032	391	402	PS01186	EGF-like region
IPR013032	437	448	PS00022	EGF-like region
IPR013032	437	452	PS01186	EGF-like region
IPR013032	480	491	PS00022	EGF-like region
IPR013032	480	495	PS01186	EGF-like region
IPR013032	523	534	PS00022	EGF-like region
IPR013032	523	538	PS01186	EGF-like region
IPR013032	566	577	PS00022	EGF-like region
IPR013032	566	581	PS01186	EGF-like region
IPR013032	609	620	PS00022	EGF-like region
IPR013032	609	624	PS01186	EGF-like region
IPR013032	652	663	PS00022	EGF-like region
IPR013032	652	667	PS01186	EGF-like region
IPR013032	697	708	PS00022	EGF-like region
IPR013032	697	712	PS01186	EGF-like region
IPR013032	740	751	PS00022	EGF-like region
IPR013032	740	755	PS01186	EGF-like region
IPR013032	783	794	PS00022	EGF-like region
IPR013032	783	798	PS01186	EGF-like region
IPR013032	826	837	PS00022	EGF-like region
IPR013032	826	841	PS01186	EGF-like region
IPR013032	869	880	PS00022	EGF-like region
IPR013032	869	880	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 909 GAIAGIIILVLVVLFLLALFII 930 PRIMARY 22

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	909	GAIAGIIILVLVVLFLLALFII	930	PRIMARY	22

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAACAACAGGGACAGGATGAC

Primer_r
: CTGTCAAGTCCAAAAGCACCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3896 bp
Genome contig ID	gi51511721f_126554514
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- ATGAGTTTATAGATTAATGCAATAAACTTTCTAAT
Flanking genome sequence (270295 - 270344)	----+--------+--------+--------+--------+----* AAAAAACTCTAGTGTTTCTTTCTATATCTGATTCTACTGTTGATTAATGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	126654514	126824807	26	99.4	Perfect prediction

Primer_f	: CAACAACAGGGACAGGATGAC
Primer_r	: CTGTCAAGTCCAAAAGCACCG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1780

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information