HUGE

Gene/Protein Characteristic Table for KIAA1781

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB058677
Description :	multiple EGF-like-domains 11.
HUGO Gene Name :	multiple EGF-like-domains 11 (MEGF11)
Clone Name :	fg06971 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5821 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES YES

Integrity of 3' end

Length of 3'UTR 2633 bp

Genome contig ID gi51511731r_63874693
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GTACCTTGTACAAAATAAAACAAATTTCTCAAACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTTAACAAGAATGCCTACTGTTGTGTTGCAAATGGAAAACGTGCTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 63974693 64203395 20 99.4 Terminal No-hit

Features of the protein sequence	Description

Length: 974 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB47410	100.0	MEGF11 protein ...	Homo sapiens
EAW77756	99.9	MEGF11 protein,...	Homo sapiens
BAF64841	99.9	MEGF11 [Homo sa...	Homo sapiens
A6BM72	99.9	Multiple epider...	Homo sapiens
NP_115821	99.8	multiple EGF-li...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058676	8.7e-186	58.9	KIAA1780
AB011539	3.9e-92	43.2	KIAA0815
D63483	2.3e-36	35.6	KIAA0149
AB053450	9.6e-19	28.2	KIAA1776
D87433	4.6e-12	26.5	KIAA0246

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002049 127 145 PR00011 EGF-like

IPR002049 691 709 PR00011 EGF-like

IPR002049 734 752 PR00011 EGF-like

HMMPfam IPR002049 76 115 PF00053 EGF-like

IPR002049 123 147 PF00053 EGF-like

IPR013111 162 188 PF07974 EGF

IPR002049 205 244 PF00053 EGF-like

IPR013111 248 274 PF07974 EGF

IPR002049 292 333 PF00053 EGF-like

IPR013111 380 406 PF07974 EGF

IPR002049 509 552 PF00053 EGF-like

IPR013111 597 623 PF07974 EGF

IPR013111 640 666 PF07974 EGF

IPR002049 687 726 PF00053 EGF-like

HMMSmart IPR006210 32 60 SM00181 EGF

IPR006210 71 103 SM00181 EGF

IPR002049 76 115 SM00180 EGF-like

IPR006210 114 146 SM00181 EGF

IPR002049 119 158 SM00180 EGF-like

IPR006210 157 189 SM00181 EGF

IPR002049 162 201 SM00180 EGF-like

IPR006210 200 232 SM00181 EGF

IPR002049 205 244 SM00180 EGF-like

IPR006210 243 275 SM00181 EGF

IPR002049 248 288 SM00180 EGF-like

IPR006210 287 321 SM00181 EGF

IPR002049 292 333 SM00180 EGF-like

IPR006210 332 364 SM00181 EGF

IPR002049 337 376 SM00180 EGF-like

IPR006210 375 407 SM00181 EGF

IPR002049 380 419 SM00180 EGF-like

IPR006210 418 450 SM00181 EGF

IPR002049 423 462 SM00180 EGF-like

IPR006210 461 493 SM00181 EGF

IPR002049 466 505 SM00180 EGF-like

IPR006210 504 536 SM00181 EGF

IPR002049 509 548 SM00180 EGF-like

IPR006210 547 581 SM00181 EGF

IPR002049 551 593 SM00180 EGF-like

IPR006210 592 624 SM00181 EGF

IPR002049 597 636 SM00180 EGF-like

IPR006210 635 667 SM00181 EGF

IPR002049 640 679 SM00180 EGF-like

IPR006210 678 710 SM00181 EGF

IPR002049 683 722 SM00180 EGF-like

IPR006210 721 753 SM00181 EGF

IPR002049 726 755 SM00180 EGF-like

ProfileScan IPR000742 29 60 PS50026 EGF-like

IPR000742 73 103 PS50026 EGF-like

IPR002049 76 117 PS50027 EGF-like

IPR000742 111 146 PS50026 EGF-like

IPR002049 119 166 PS50027 EGF-like

IPR000742 154 189 PS50026 EGF-like

IPR000742 197 232 PS50026 EGF-like

IPR002049 205 252 PS50027 EGF-like

IPR000742 240 275 PS50026 EGF-like

IPR002049 292 335 PS50027 EGF-like

IPR000742 329 364 PS50026 EGF-like

IPR000742 372 407 PS50026 EGF-like

IPR002049 380 425 PS50027 EGF-like

IPR000742 420 450 PS50026 EGF-like

IPR002049 466 513 PS50027 EGF-like

IPR000742 501 536 PS50026 EGF-like

IPR002049 552 595 PS50027 EGF-like

IPR000742 589 624 PS50026 EGF-like

IPR000742 637 667 PS50026 EGF-like

IPR000742 680 710 PS50026 EGF-like

IPR002049 683 724 PS50027 EGF-like

IPR000742 718 753 PS50026 EGF-like

ScanRegExp IPR013032 48 59 PS00022 EGF-like region

IPR013032 48 63 PS01186 EGF-like region

IPR013032 91 102 PS00022 EGF-like region

IPR013032 91 106 PS01186 EGF-like region

IPR013032 134 145 PS00022 EGF-like region

IPR013032 134 149 PS01186 EGF-like region

IPR013032 177 188 PS00022 EGF-like region

IPR013032 177 192 PS01186 EGF-like region

IPR013032 220 231 PS00022 EGF-like region

IPR013032 220 235 PS01186 EGF-like region

IPR013032 263 274 PS00022 EGF-like region

IPR013032 263 274 PS01186 EGF-like region

IPR013032 309 320 PS00022 EGF-like region

IPR013032 309 324 PS01186 EGF-like region

IPR013032 352 363 PS00022 EGF-like region

IPR013032 352 367 PS01186 EGF-like region

IPR013032 395 406 PS00022 EGF-like region

IPR013032 395 410 PS01186 EGF-like region

IPR013032 438 449 PS00022 EGF-like region

IPR013032 438 453 PS01186 EGF-like region

IPR013032 481 492 PS00022 EGF-like region

IPR013032 481 496 PS01186 EGF-like region

IPR013032 524 535 PS00022 EGF-like region

IPR013032 524 539 PS01186 EGF-like region

IPR013032 569 580 PS00022 EGF-like region

IPR013032 569 584 PS01186 EGF-like region

IPR013032 612 623 PS00022 EGF-like region

IPR013032 612 627 PS01186 EGF-like region

IPR013032 655 666 PS00022 EGF-like region

IPR013032 655 670 PS01186 EGF-like region

IPR013032 698 709 PS00022 EGF-like region

IPR013032 698 713 PS01186 EGF-like region

IPR013032 741 752 PS00022 EGF-like region

IPR013032 741 752 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002049	127	145	PR00011	EGF-like
IPR002049	691	709	PR00011	EGF-like
IPR002049	734	752	PR00011	EGF-like
HMMPfam	IPR002049	76	115	PF00053	EGF-like
IPR002049	123	147	PF00053	EGF-like
IPR013111	162	188	PF07974	EGF
IPR002049	205	244	PF00053	EGF-like
IPR013111	248	274	PF07974	EGF
IPR002049	292	333	PF00053	EGF-like
IPR013111	380	406	PF07974	EGF
IPR002049	509	552	PF00053	EGF-like
IPR013111	597	623	PF07974	EGF
IPR013111	640	666	PF07974	EGF
IPR002049	687	726	PF00053	EGF-like
HMMSmart	IPR006210	32	60	SM00181	EGF
IPR006210	71	103	SM00181	EGF
IPR002049	76	115	SM00180	EGF-like
IPR006210	114	146	SM00181	EGF
IPR002049	119	158	SM00180	EGF-like
IPR006210	157	189	SM00181	EGF
IPR002049	162	201	SM00180	EGF-like
IPR006210	200	232	SM00181	EGF
IPR002049	205	244	SM00180	EGF-like
IPR006210	243	275	SM00181	EGF
IPR002049	248	288	SM00180	EGF-like
IPR006210	287	321	SM00181	EGF
IPR002049	292	333	SM00180	EGF-like
IPR006210	332	364	SM00181	EGF
IPR002049	337	376	SM00180	EGF-like
IPR006210	375	407	SM00181	EGF
IPR002049	380	419	SM00180	EGF-like
IPR006210	418	450	SM00181	EGF
IPR002049	423	462	SM00180	EGF-like
IPR006210	461	493	SM00181	EGF
IPR002049	466	505	SM00180	EGF-like
IPR006210	504	536	SM00181	EGF
IPR002049	509	548	SM00180	EGF-like
IPR006210	547	581	SM00181	EGF
IPR002049	551	593	SM00180	EGF-like
IPR006210	592	624	SM00181	EGF
IPR002049	597	636	SM00180	EGF-like
IPR006210	635	667	SM00181	EGF
IPR002049	640	679	SM00180	EGF-like
IPR006210	678	710	SM00181	EGF
IPR002049	683	722	SM00180	EGF-like
IPR006210	721	753	SM00181	EGF
IPR002049	726	755	SM00180	EGF-like
ProfileScan	IPR000742	29	60	PS50026	EGF-like
IPR000742	73	103	PS50026	EGF-like
IPR002049	76	117	PS50027	EGF-like
IPR000742	111	146	PS50026	EGF-like
IPR002049	119	166	PS50027	EGF-like
IPR000742	154	189	PS50026	EGF-like
IPR000742	197	232	PS50026	EGF-like
IPR002049	205	252	PS50027	EGF-like
IPR000742	240	275	PS50026	EGF-like
IPR002049	292	335	PS50027	EGF-like
IPR000742	329	364	PS50026	EGF-like
IPR000742	372	407	PS50026	EGF-like
IPR002049	380	425	PS50027	EGF-like
IPR000742	420	450	PS50026	EGF-like
IPR002049	466	513	PS50027	EGF-like
IPR000742	501	536	PS50026	EGF-like
IPR002049	552	595	PS50027	EGF-like
IPR000742	589	624	PS50026	EGF-like
IPR000742	637	667	PS50026	EGF-like
IPR000742	680	710	PS50026	EGF-like
IPR002049	683	724	PS50027	EGF-like
IPR000742	718	753	PS50026	EGF-like
ScanRegExp	IPR013032	48	59	PS00022	EGF-like region
IPR013032	48	63	PS01186	EGF-like region
IPR013032	91	102	PS00022	EGF-like region
IPR013032	91	106	PS01186	EGF-like region
IPR013032	134	145	PS00022	EGF-like region
IPR013032	134	149	PS01186	EGF-like region
IPR013032	177	188	PS00022	EGF-like region
IPR013032	177	192	PS01186	EGF-like region
IPR013032	220	231	PS00022	EGF-like region
IPR013032	220	235	PS01186	EGF-like region
IPR013032	263	274	PS00022	EGF-like region
IPR013032	263	274	PS01186	EGF-like region
IPR013032	309	320	PS00022	EGF-like region
IPR013032	309	324	PS01186	EGF-like region
IPR013032	352	363	PS00022	EGF-like region
IPR013032	352	367	PS01186	EGF-like region
IPR013032	395	406	PS00022	EGF-like region
IPR013032	395	410	PS01186	EGF-like region
IPR013032	438	449	PS00022	EGF-like region
IPR013032	438	453	PS01186	EGF-like region
IPR013032	481	492	PS00022	EGF-like region
IPR013032	481	496	PS01186	EGF-like region
IPR013032	524	535	PS00022	EGF-like region
IPR013032	524	539	PS01186	EGF-like region
IPR013032	569	580	PS00022	EGF-like region
IPR013032	569	584	PS01186	EGF-like region
IPR013032	612	623	PS00022	EGF-like region
IPR013032	612	627	PS01186	EGF-like region
IPR013032	655	666	PS00022	EGF-like region
IPR013032	655	670	PS01186	EGF-like region
IPR013032	698	709	PS00022	EGF-like region
IPR013032	698	713	PS01186	EGF-like region
IPR013032	741	752	PS00022	EGF-like region
IPR013032	741	752	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 778 SVGAVTGIMLLLFFIVVLLGLF 799 PRIMARY 22

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	778	SVGAVTGIMLLLFFIVVLLGLF	799	PRIMARY	22

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCTGGCTTTGTCATATCTAC

Primer_r
: GACCAAATAAAATGAGGAGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: "15, 18"

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	YES

Length of 3'UTR	2633 bp
Genome contig ID	gi51511731r_63874693
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTACCTTGTACAAAATAAAACAAATTTCTCAAACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTAACAAGAATGCCTACTGTTGTGTTGCAAATGGAAAACGTGCTTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	63974693	64203395	20	99.4	Terminal No-hit

Primer_f	: TCCTGGCTTTGTCATATCTAC
Primer_r	: GACCAAATAAAATGAGGAGGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1781

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information