HUGE

Gene/Protein Characteristic Table for KIAA0976

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00705
Accession No. :	AB023193
Description :	Netrin-G1 precursor.
HUGO Gene Name :	netrin G1 (NTNG1)
Clone Name :	hj06950 [Vector Info]
Flexi ORF Clone :	pF1KSDA0976
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4704 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2870 bp

Genome contig ID gi89161185f_107385072
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AATTAATGAATCCCAAAATAAATCTGTAGCCTTTG
Flanking genome sequence
(369660 - 369709)
----+----*----+----*----+----*----+----*----+----*
AGCCTTATGATCTATGTTTTCACTTTACCTGATGTGGTAGGAATTCCTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 107485072 107754730 5 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 386 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAH73828	8.8e-166	100.0	netrin G1 [Homo...	Homo sapiens
CAD98143	8.8e-166	100.0	hypothetical pr...	Homo sapiens
AAH30220	4.1e-165	99.7	Netrin G1 [Homo...	Homo sapiens
CAH73833	5e-165	99.7	netrin G1 [Homo...	Homo sapiens
CAH73829	5.1e-165	99.7	netrin G1 [Homo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058760	1.3e-84	57.5	KIAA1857
AB067494	4.5e-11	29.7	KIAA1907

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008211 72 317 PF00055 Laminin

IPR002049 319 363 PF00053 EGF-like

HMMSmart IPR008211 81 317 SM00136 Laminin

IPR002049 319 376 SM00180 EGF-like

ProfileScan IPR008211 68 318 PS51117 Laminin

ScanRegExp IPR013032 337 348 PS00022 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008211	72	317	PF00055	Laminin
IPR002049	319	363	PF00053	EGF-like
HMMSmart	IPR008211	81	317	SM00136	Laminin
IPR002049	319	376	SM00180	EGF-like
ProfileScan	IPR008211	68	318	PS51117	Laminin
ScanRegExp	IPR013032	337	348	PS00022	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAATGCATGGATAGGGTGGTC

Primer_r
: AGATAGACAACAGCAGGTACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAATGCATGGATAGGGTGGTC
Primer_r	: AGATAGACAACAGCAGGTACG
PCR product length	: 100 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2870 bp
Genome contig ID	gi89161185f_107385072
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATTAATGAATCCCAAAATAAATCTGTAGCCTTTG
Flanking genome sequence (369660 - 369709)	----+--------+--------+--------+--------+----* AGCCTTATGATCTATGTTTTCACTTTACCTGATGTGGTAGGAATTCCTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	107485072	107754730	5	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0976

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information