HUGE

Gene/Protein Characteristic Table for KIAA1114

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK01150
Accession No. :	AB029037
Description :	Trophinin.
HUGO Gene Name :	trophinin (TRO)
Clone Name :	fj15925 [Vector Info]
Flexi ORF Clone :	pF1KA1114
Source :	Human fetal brain
Note :	We replaced hj06833, former representative clones for KIAA1114 with fj15925. (2004/1/10)

Features of the cloned DNA sequence	Description

Length: 4614 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 237 bp

Genome contig ID gi89161218f_54865359
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
TTTTGGTATCAGAGTTACATTAAATTTGCAAAATG
Flanking genome sequence
(109230 - 109279)
----+----*----+----*----+----*----+----*----+----*
AATTGGAGTTTTTTCTGTCTTTTAATGTGCTTAGGTAGTTGTGGAGTGGC

Features of the protein sequence	Description

Length: 1458 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q12816	100.0	Trophinin; MAGE...	Homo sapiens
EAW93202	100.0	trophinin, isof...	Homo sapiens
EAW93206	100.0	trophinin, isof...	Homo sapiens
CAM26848	99.9	trophinin [Homo...	Homo sapiens
BAG59020	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058762	4.2e-41	41.8	KIAA1859
AB046807	8.6e-18	25.5	KIAA1587
AB014518	5.1e-09	28.1	KIAA0618
D14689	1.4e-06	28.1	KIAA0023
AB107354	0.0008	24.5	KIAA2032

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002190 478 647 PF01454 MAGE protein

ProfileScan IPR002190 471 669 PS50838 MAGE protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002190	478	647	PF01454	MAGE protein
ProfileScan	IPR002190	471	669	PS50838	MAGE protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCCCCATGTTTACAGATACC
Primer_r	: CCATAACTGCCTTGACTGCTG
PCR product length	: 105 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	237 bp
Genome contig ID	gi89161218f_54865359
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- TTTTGGTATCAGAGTTACATTAAATTTGCAAAATG
Flanking genome sequence (109230 - 109279)	----+--------+--------+--------+--------+----* AATTGGAGTTTTTTCTGTCTTTTAATGTGCTTAGGTAGTTGTGGAGTGGC

Gene/Protein Characteristic Table for KIAA1114

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information