| HUGE |
Gene/Protein Characteristic Table for KIAA2032 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00312 |
|---|---|
| Accession No. : | AB107354 |
| Description : | |
| HUGO Gene Name : | |
| Clone Name : | eh00720 [Vector Info] |
| Flexi ORF Clone : | pF1KA2032
|
| Source : |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5168 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1499 bp Genome contig ID gi51511729r_38382003 PolyA signal sequence
(CATAAA,-21)
CTTAAATCTATACCCATAAAACTTCTTTTAAGATTFlanking genome sequence
(100000 - 99951)
ATATTGTGTTTTTTATATATGTTGACCATTCATTCAGAAAATAATTATTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 r 38482003 38510213 13 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 952 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
RH mapping information |
Description | |
|---|---|---|
| : 13 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
