ROUGE

Gene/Protein Characteristic Table for mKIAA1114

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122449
Description :	trophinin. melanoma antigen, family D, 3. trophinin-2. magphinin-alpha. magphinin-gamma. magphinin-beta 2. necdin and trophinin like. melanoma antigen, family D, 3-like.
Clone Name :	mbg06405 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5434 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 223 bp

Genome contig ID gi66880665r_144079706
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
TTTTGGTATTAGAGTTACATTAAATTTGCCAAAGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCTGAGCTTATTCTGTCCTTTAATGTGACTGCATGTGATGTTTTGGGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1114 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA1114	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 1..5211
Length: 1736 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAK01205	94.7	mage-d3 [Mus mu...	Mus musculus
AAH75630	98.4	Tro protein [Mu...	Mus musculus
AAH53018	98.4	Tro protein [Mu...	Mus musculus
AAK61335	93.6	trophinin [Mus ...	Mus musculus
AAK12835	93.5	cell adhesion p...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220150	1.9e-36	59.6	mFLJ00163
AK131157	5.1e-17	46.2	mFLJ00211
BC059039	2.3e-15	37.3	mKIAA1587
AK122189	1.3e-06	27.3	mKIAA0023
AK172982	2.4e-05	27.2	mKIAA0618

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002190 66 379 PF01454 MAGE protein

ProfileScan IPR002190 258 456 PS50838 MAGE protein

NULL 550 1736 PS50315 NULL

NULL 690 1055 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002190	66	379	PF01454	MAGE protein
ProfileScan	IPR002190	258	456	PS50838	MAGE protein
NULL	550	1736	PS50315	NULL
NULL	690	1055	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	223 bp
Genome contig ID	gi66880665r_144079706
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- TTTTGGTATTAGAGTTACATTAAATTTGCCAAAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCTGAGCTTATTCTGTCCTTTAATGTGACTGCATGTGATGTTTTGGGT

Gene/Protein Characteristic Table for mKIAA1114

Features of the cloned DNA sequence

Features of the protein sequence