HUGE |
Gene/Protein Characteristic Table for KIAA0023 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00369 |
---|---|
Accession No. : | D14689 |
Description : | Nuclear pore complex protein Nup214. |
HUGO Gene Name : | |
Clone Name : | ha00512 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0023
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6642 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 305 bp Genome contig ID gi89161216f_132890858 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
GTTTTCCCTCCCACTATTAAACAGTCTGTTTCCGTFlanking genome sequence
(208053 - 208102) ----+----*----+----*----+----*----+----*----+----*
ACAGAACGTATGTGGGTTTTTTCAGATCACAGCCAAGAAGATTGCCCCGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 f 132990858 133098909 37 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2111 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMSmart | IPR001680 | 156 | 196 | SM00320 | WD40 repeat |
IPR001680 | 200 | 238 | SM00320 | WD40 repeat |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 9 |
: Genebridge 4 | |
: TACCCCCTCCCTGCCTATGT | |
: GGCTGACTGTTGCTCCTCTA | |
: 130 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |