| HUGE | 
| Gene/Protein Characteristic Table for KIAA1587 | 
| Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00872 | 
|---|---|
| Accession No. : | AB046807 | 
| Description : | Melanoma-associated antigen E1. | 
| HUGO Gene Name : | melanoma antigen family E, 1 (MAGEE1) | 
| Clone Name : | fj08327 [Vector Info] | 
| Flexi ORF Clone : | pF1KSDA1587  | 
| Source : | Human fetal brain | 
| Features of the cloned DNA sequence | Description | |
|---|---|---|
Length: 3628 bp
|   | 
| cloned DNA seq. | |
| Warning for N-terminal truncation: | NO | 
| Warning for coding interruption: | NO | 
Length of 3'UTR 547 bp Genome contig ID gi89161218f_75464521 PolyA signal sequence 
(AATAAA,-20)
GAAAAATAAAAGATTAATAAATGAAACATAATGCTFlanking genome sequence 
(103629 - 103678)
AATACACTGACTTATTCAACTGCTTTCATACAGTGAGCACAGTGGTGTGC
| Features of the protein sequence | Description | |
|---|---|---|
Length: 991 aa
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 
    | Expression profile | Description | |
|---|---|---|
| RT-PCR-ELISA | Description | 
|---|

Experimental conditions
| : GTTTACGGGTTCCTGACAGTG | |
| : AACATCAGCTCTATTGGCCTC | |
| : 95 °C | 
| RH mapping information | Description | |
|---|---|---|
| : X | 
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - | 
| How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage   | |