HUGE |
Gene/Protein Characteristic Table for KIAA0862 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00664 |
---|---|
Accession No. : | AB020669 |
Description : | Leucine-rich repeat protein SHOC-2. |
HUGO Gene Name : | soc-2 suppressor of clear homolog (C. elegans) (SHOC2) |
Clone Name : | hk06532 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0862
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3872 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1846 bp Genome contig ID gi89161187f_112569363 PolyA signal sequence
(TATAAA,-33) +----*----+----*----+----*----+----
TTTATAAAAGGAATTTGTTTATTACAGCTCTACCTFlanking genome sequence
(194051 - 194100) ----+----*----+----*----+----*----+----*----+----*
AGAGCTTGTGTGTTTGTGTGGTTTTTTAAATCTCGTATCCAGGTGTGTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 112669363 112763412 9 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 584 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 150 | 163 | PR00019 | Leucine-rich repeat |
IPR001611 | 170 | 183 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 126 | 147 | PF00560 | Leucine-rich repeat |
IPR001611 | 149 | 170 | PF00560 | Leucine-rich repeat | |
IPR001611 | 172 | 193 | PF00560 | Leucine-rich repeat | |
IPR001611 | 195 | 216 | PF00560 | Leucine-rich repeat | |
IPR001611 | 218 | 239 | PF00560 | Leucine-rich repeat | |
IPR001611 | 241 | 262 | PF00560 | Leucine-rich repeat | |
IPR001611 | 264 | 285 | PF00560 | Leucine-rich repeat | |
IPR001611 | 287 | 308 | PF00560 | Leucine-rich repeat | |
IPR001611 | 310 | 332 | PF00560 | Leucine-rich repeat | |
IPR001611 | 358 | 380 | PF00560 | Leucine-rich repeat | |
IPR001611 | 382 | 403 | PF00560 | Leucine-rich repeat | |
IPR001611 | 405 | 426 | PF00560 | Leucine-rich repeat | |
IPR001611 | 428 | 449 | PF00560 | Leucine-rich repeat | |
IPR001611 | 451 | 472 | PF00560 | Leucine-rich repeat | |
IPR001611 | 474 | 495 | PF00560 | Leucine-rich repeat | |
IPR001611 | 497 | 518 | PF00560 | Leucine-rich repeat | |
IPR001611 | 520 | 542 | PF00560 | Leucine-rich repeat | |
HMMSmart | IPR003591 | 124 | 146 | SM00369 | Leucine-rich repeat |
NULL | 124 | 143 | SM00364 | NULL | |
NULL | 124 | 142 | SM00365 | NULL | |
IPR003591 | 147 | 169 | SM00369 | Leucine-rich repeat | |
NULL | 147 | 166 | SM00364 | NULL | |
NULL | 170 | 189 | SM00364 | NULL | |
NULL | 170 | 191 | SM00365 | NULL | |
IPR003591 | 170 | 192 | SM00369 | Leucine-rich repeat | |
NULL | 193 | 218 | SM00365 | NULL | |
IPR003591 | 193 | 215 | SM00369 | Leucine-rich repeat | |
NULL | 216 | 235 | SM00364 | NULL | |
IPR003591 | 216 | 237 | SM00369 | Leucine-rich repeat | |
IPR003591 | 239 | 262 | SM00369 | Leucine-rich repeat | |
NULL | 239 | 258 | SM00364 | NULL | |
NULL | 239 | 270 | SM00365 | NULL | |
NULL | 262 | 281 | SM00364 | NULL | |
NULL | 285 | 304 | SM00364 | NULL | |
IPR003591 | 285 | 308 | SM00369 | Leucine-rich repeat | |
NULL | 308 | 327 | SM00364 | NULL | |
IPR003591 | 309 | 331 | SM00369 | Leucine-rich repeat | |
IPR003591 | 332 | 355 | SM00369 | Leucine-rich repeat | |
IPR003591 | 356 | 379 | SM00369 | Leucine-rich repeat | |
IPR003591 | 403 | 425 | SM00369 | Leucine-rich repeat | |
IPR003591 | 426 | 448 | SM00369 | Leucine-rich repeat | |
NULL | 426 | 445 | SM00364 | NULL | |
NULL | 449 | 468 | SM00364 | NULL | |
NULL | 449 | 467 | SM00365 | NULL | |
IPR003591 | 449 | 471 | SM00369 | Leucine-rich repeat | |
NULL | 472 | 491 | SM00364 | NULL | |
IPR003591 | 472 | 494 | SM00369 | Leucine-rich repeat | |
NULL | 495 | 523 | SM00365 | NULL | |
IPR003591 | 495 | 516 | SM00369 | Leucine-rich repeat | |
NULL | 495 | 514 | SM00364 | NULL | |
IPR003591 | 518 | 542 | SM00369 | Leucine-rich repeat |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACTGTTGTTCTGCTTTTCCTG | |
: TCTTCACCTGCCTTCCATTTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |