ROUGE |
Gene/Protein Characteristic Table for mKIAA0862 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC049775 |
---|---|
Leucine-rich repeat protein SHOC-2. | |
mpj01572 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2588 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 619 bp Genome contig ID gi65553144f_53466339 PolyA signal sequence
(AATATA,-20) +----*----+----*----+----*----+----
AGCTGGCAAACAGAAAATATACATTTAGAAATCAGFlanking genome sequence
(144437 - 144486) ----+----*----+----*----+----*----+----*----+----*
AATTTCCATTAGTTTTATTTCTCCAGTGAACTTTAAAGCAAATATCTGAA
KIAA Alignment based on: KIAA0862 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 215..1969
Length: 584 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |