HUGE

Gene/Protein Characteristic Table for KIAA1225

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00772
Accession No. :	AB033051
Description :	Protein LAP2.
HUGO Gene Name :
Clone Name :	fh04221s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1225
Source :	Human fetal brain
Note :	We replaced fh04221, former representative clones for KIAA1225 with fh04221s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6064 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1948 bp

Genome contig ID gi51511721f_65224303
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GATAAAATTCACTTATTGTATGTGTGTTGTAATCT
Flanking genome sequence
(187761 - 187810)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGAATGACAAACAGCTTCTTTAAGACAAGTCTCGGTGTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 65324303 65412062 23 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1371 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI26465	99.9	Erbb2 interacti...	Homo sapiens
XP_001162804	99.8	ERBB2 interacti...	Pan troglodytes
AAI15013	99.6	Erbb2 interacti...	Homo sapiens
AAI15016	99.1	ERBB2IP protein...	Homo sapiens
BAG65463	98.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D63481	1.7e-40	39.1	KIAA0147
AB020669	7.9e-13	29.7	KIAA0862
AB037786	3.4e-11	32.1	KIAA1365
AB023233	7.3e-06	22.7	KIAA1016
AB037858	8.7e-06	28.0	KIAA1437

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 232 245 PR00019 Leucine-rich repeat

IPR001611 367 380 PR00019 Leucine-rich repeat

HMMPfam IPR001611 47 68 PF00560 Leucine-rich repeat

IPR001611 70 91 PF00560 Leucine-rich repeat

IPR001611 93 114 PF00560 Leucine-rich repeat

IPR001611 139 160 PF00560 Leucine-rich repeat

IPR001611 162 183 PF00560 Leucine-rich repeat

IPR001611 185 206 PF00560 Leucine-rich repeat

IPR001611 231 252 PF00560 Leucine-rich repeat

IPR001611 254 275 PF00560 Leucine-rich repeat

IPR001611 277 298 PF00560 Leucine-rich repeat

IPR001611 300 321 PF00560 Leucine-rich repeat

IPR001611 346 367 PF00560 Leucine-rich repeat

IPR001611 369 390 PF00560 Leucine-rich repeat

IPR001478 1282 1366 PF00595 PDZ/DHR/GLGF

HMMSmart NULL 45 63 SM00365 NULL

NULL 45 64 SM00364 NULL

IPR003591 48 68 SM00369 Leucine-rich repeat

NULL 68 87 SM00364 NULL

NULL 91 113 SM00365 NULL

NULL 91 110 SM00364 NULL

IPR003591 91 114 SM00369 Leucine-rich repeat

IPR003591 137 159 SM00369 Leucine-rich repeat

NULL 160 191 SM00365 NULL

IPR003591 160 182 SM00369 Leucine-rich repeat

NULL 160 179 SM00364 NULL

NULL 183 202 SM00364 NULL

IPR003591 183 205 SM00369 Leucine-rich repeat

NULL 206 227 SM00365 NULL

IPR003591 206 228 SM00369 Leucine-rich repeat

IPR003591 229 252 SM00369 Leucine-rich repeat

NULL 229 251 SM00365 NULL

NULL 252 271 SM00364 NULL

IPR003591 253 274 SM00369 Leucine-rich repeat

IPR003591 275 298 SM00369 Leucine-rich repeat

NULL 275 294 SM00364 NULL

IPR003591 321 344 SM00369 Leucine-rich repeat

NULL 345 363 SM00364 NULL

IPR003591 345 366 SM00369 Leucine-rich repeat

NULL 367 386 SM00364 NULL

NULL 367 385 SM00365 NULL

IPR003591 367 389 SM00369 Leucine-rich repeat

NULL 390 411 SM00365 NULL

IPR001478 1289 1369 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001478 1280 1369 PS50106 PDZ/DHR/GLGF

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	232	245	PR00019	Leucine-rich repeat
IPR001611	367	380	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	47	68	PF00560	Leucine-rich repeat
IPR001611	70	91	PF00560	Leucine-rich repeat
IPR001611	93	114	PF00560	Leucine-rich repeat
IPR001611	139	160	PF00560	Leucine-rich repeat
IPR001611	162	183	PF00560	Leucine-rich repeat
IPR001611	185	206	PF00560	Leucine-rich repeat
IPR001611	231	252	PF00560	Leucine-rich repeat
IPR001611	254	275	PF00560	Leucine-rich repeat
IPR001611	277	298	PF00560	Leucine-rich repeat
IPR001611	300	321	PF00560	Leucine-rich repeat
IPR001611	346	367	PF00560	Leucine-rich repeat
IPR001611	369	390	PF00560	Leucine-rich repeat
IPR001478	1282	1366	PF00595	PDZ/DHR/GLGF
HMMSmart	NULL	45	63	SM00365	NULL
NULL	45	64	SM00364	NULL
IPR003591	48	68	SM00369	Leucine-rich repeat
NULL	68	87	SM00364	NULL
NULL	91	113	SM00365	NULL
NULL	91	110	SM00364	NULL
IPR003591	91	114	SM00369	Leucine-rich repeat
IPR003591	137	159	SM00369	Leucine-rich repeat
NULL	160	191	SM00365	NULL
IPR003591	160	182	SM00369	Leucine-rich repeat
NULL	160	179	SM00364	NULL
NULL	183	202	SM00364	NULL
IPR003591	183	205	SM00369	Leucine-rich repeat
NULL	206	227	SM00365	NULL
IPR003591	206	228	SM00369	Leucine-rich repeat
IPR003591	229	252	SM00369	Leucine-rich repeat
NULL	229	251	SM00365	NULL
NULL	252	271	SM00364	NULL
IPR003591	253	274	SM00369	Leucine-rich repeat
IPR003591	275	298	SM00369	Leucine-rich repeat
NULL	275	294	SM00364	NULL
IPR003591	321	344	SM00369	Leucine-rich repeat
NULL	345	363	SM00364	NULL
IPR003591	345	366	SM00369	Leucine-rich repeat
NULL	367	386	SM00364	NULL
NULL	367	385	SM00365	NULL
IPR003591	367	389	SM00369	Leucine-rich repeat
NULL	390	411	SM00365	NULL
IPR001478	1289	1369	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	1280	1369	PS50106	PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCGAGCTAATACTGCATACC

Primer_r
: TCACCAAGATTTACAGAGGCT

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1948 bp
Genome contig ID	gi51511721f_65224303
PolyA signal sequence (None)	+--------+--------+----*----+---- GATAAAATTCACTTATTGTATGTGTGTTGTAATCT
Flanking genome sequence (187761 - 187810)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGAATGACAAACAGCTTCTTTAAGACAAGTCTCGGTGTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	65324303	65412062	23	99.9	Perfect prediction

Primer_f	: TTCGAGCTAATACTGCATACC
Primer_r	: TCACCAAGATTTACAGAGGCT
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1225

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information