HUGE

Gene/Protein Characteristic Table for KIAA0606

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01103
Accession No. :	AB011178
Description :	PH domain leucine-rich repeat-containing protein phosphatase.
HUGO Gene Name :	PH domain and leucine rich repeat protein phosphatase (PHLPP)
Clone Name :	ph00195 [Vector Info]
Flexi ORF Clone :	pF1KA0606
Source :	Human brain (hippocampus)
Note :	We replaced hg04452a, former representative clones for KIAA0606 with ph00195. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5113 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1001 bp

Genome contig ID gi51511735f_58434939
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TAATTTTTGTTACAATAAATATGAAATTTACAAGT
Flanking genome sequence
(363708 - 363757)
----+----*----+----*----+----*----+----*----+----*
ATTTACAAGTATCTGCTTTTGTCTCAGCAGCCAGATGTTTCTTGGAGACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 f 58534939 58798645 17 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1369 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60346	99.9	PH domain leuci...	Homo sapiens
XP_523952	99.2	PH domain and l...	Pan troglodytes
XP_001094216	98.7	PH domain and l...	Macaca mulatta
EDL91741	90.4	PH domain and l...	Rattus norvegicus
Q9WTR8	90.4	PH domain leuci...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023148	3.6e-55	51.4	KIAA0931
AB020669	1.6e-08	28.1	KIAA0862
D63481	1.4e-05	27.6	KIAA0147

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 548 561 PR00019 Leucine-rich repeat

IPR001611 711 724 PR00019 Leucine-rich repeat

HMMPfam IPR001849 189 288 PF00169 Pleckstrin-like

IPR001611 290 308 PF00560 Leucine-rich repeat

IPR001611 344 365 PF00560 Leucine-rich repeat

IPR001611 367 388 PF00560 Leucine-rich repeat

IPR001611 390 411 PF00560 Leucine-rich repeat

IPR001611 413 434 PF00560 Leucine-rich repeat

IPR001611 570 592 PF00560 Leucine-rich repeat

IPR001611 615 633 PF00560 Leucine-rich repeat

IPR001611 639 661 PF00560 Leucine-rich repeat

IPR001611 689 711 PF00560 Leucine-rich repeat

IPR001611 713 734 PF00560 Leucine-rich repeat

IPR001611 781 803 PF00560 Leucine-rich repeat

IPR014045 826 1067 PF00481 Protein phosphatase 2C

HMMSmart IPR003591 342 365 SM00369 Leucine-rich repeat

NULL 344 361 SM00364 NULL

NULL 365 384 SM00364 NULL

IPR003591 388 410 SM00369 Leucine-rich repeat

IPR003591 411 433 SM00369 Leucine-rich repeat

NULL 411 430 SM00364 NULL

IPR003591 434 457 SM00369 Leucine-rich repeat

IPR003591 482 505 SM00369 Leucine-rich repeat

NULL 545 564 SM00364 NULL

NULL 568 587 SM00364 NULL

IPR003591 569 591 SM00369 Leucine-rich repeat

NULL 591 610 SM00364 NULL

IPR003591 592 614 SM00369 Leucine-rich repeat

NULL 615 632 SM00364 NULL

IPR003591 615 636 SM00369 Leucine-rich repeat

NULL 637 656 SM00364 NULL

IPR003591 639 660 SM00369 Leucine-rich repeat

NULL 687 706 SM00364 NULL

NULL 711 730 SM00364 NULL

IPR003591 711 734 SM00369 Leucine-rich repeat

IPR001932 817 1072 SM00332 Protein phosphatase 2C-related

ProfileScan IPR001849 188 288 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	548	561	PR00019	Leucine-rich repeat
IPR001611	711	724	PR00019	Leucine-rich repeat
HMMPfam	IPR001849	189	288	PF00169	Pleckstrin-like
IPR001611	290	308	PF00560	Leucine-rich repeat
IPR001611	344	365	PF00560	Leucine-rich repeat
IPR001611	367	388	PF00560	Leucine-rich repeat
IPR001611	390	411	PF00560	Leucine-rich repeat
IPR001611	413	434	PF00560	Leucine-rich repeat
IPR001611	570	592	PF00560	Leucine-rich repeat
IPR001611	615	633	PF00560	Leucine-rich repeat
IPR001611	639	661	PF00560	Leucine-rich repeat
IPR001611	689	711	PF00560	Leucine-rich repeat
IPR001611	713	734	PF00560	Leucine-rich repeat
IPR001611	781	803	PF00560	Leucine-rich repeat
IPR014045	826	1067	PF00481	Protein phosphatase 2C
HMMSmart	IPR003591	342	365	SM00369	Leucine-rich repeat
NULL	344	361	SM00364	NULL
NULL	365	384	SM00364	NULL
IPR003591	388	410	SM00369	Leucine-rich repeat
IPR003591	411	433	SM00369	Leucine-rich repeat
NULL	411	430	SM00364	NULL
IPR003591	434	457	SM00369	Leucine-rich repeat
IPR003591	482	505	SM00369	Leucine-rich repeat
NULL	545	564	SM00364	NULL
NULL	568	587	SM00364	NULL
IPR003591	569	591	SM00369	Leucine-rich repeat
NULL	591	610	SM00364	NULL
IPR003591	592	614	SM00369	Leucine-rich repeat
NULL	615	632	SM00364	NULL
IPR003591	615	636	SM00369	Leucine-rich repeat
NULL	637	656	SM00364	NULL
IPR003591	639	660	SM00369	Leucine-rich repeat
NULL	687	706	SM00364	NULL
NULL	711	730	SM00364	NULL
IPR003591	711	734	SM00369	Leucine-rich repeat
IPR001932	817	1072	SM00332	Protein phosphatase 2C-related
ProfileScan	IPR001849	188	288	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGTCCCAGCCTTCCCACTTTG

Primer_r
: ACTCTGGGTATGTAAATGGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGTCCCAGCCTTCCCACTTTG
Primer_r	: ACTCTGGGTATGTAAATGGCC
PCR product length	: 107 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1001 bp
Genome contig ID	gi51511735f_58434939
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TAATTTTTGTTACAATAAATATGAAATTTACAAGT
Flanking genome sequence (363708 - 363757)	----+--------+--------+--------+--------+----* ATTTACAAGTATCTGCTTTTGTCTCAGCAGCCAGATGTTTCTTGGAGACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	f	58534939	58798645	17	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0606

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information