HUGE

Gene/Protein Characteristic Table for KIAA0931

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK02004
Accession No. :	AB023148
Description :	PH domain leucine-rich repeat protein phosphatase-like.
HUGO Gene Name :	PH domain and leucine rich repeat protein phosphatase-like (PHLPPL)
Clone Name :	bf00159 [Vector Info]
Flexi ORF Clone :	pF1KA0931
Source :	Human adult brain
Note :	We replaced hh03806, former representative clones for KIAA0931 with bf00159. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 8449 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3952 bp

Genome contig ID gi51511732r_70136393
PolyA signal sequence
(AATAAA,-33)
+----*----+----*----+----*----+----
AAAATAAAGTGGAATCTTTTTCATGGCTTTGTTTT
Flanking genome sequence
(99939 - 99890)
----+----*----+----*----+----*----+----*----+----*
AAAATGGAGTGCTTGTTATTTCATAAGTATTTTAGCATGAAGCTATAATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 70236332 70317366 21 99.0 Both No-hit

Features of the protein sequence	Description

Length: 1258 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72679	100.0	PH domain and l...	synthetic construct
XP_001105908	98.6	similar to PH d...	Macaca mulatta
Q6ZVD8	94.9	PH domain leuci...	Homo sapiens
AAI29928	94.9	PH domain and l...	Homo sapiens
CAL38419	94.6	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011178	1.5e-81	51.4	KIAA0606
AB020669	1.4e-15	27.1	KIAA0862
D63481	2.4e-11	29.9	KIAA0147
AB033051	5.6e-08	28.0	KIAA1225
AB014544	1e-05	27.8	KIAA0644

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 574 587 PR00019 Leucine-rich repeat

IPR001611 602 615 PR00019 Leucine-rich repeat

HMMPfam IPR001611 302 323 PF00560 Leucine-rich repeat

IPR001611 325 346 PF00560 Leucine-rich repeat

IPR001611 348 369 PF00560 Leucine-rich repeat

IPR001611 371 392 PF00560 Leucine-rich repeat

IPR001611 442 464 PF00560 Leucine-rich repeat

IPR001611 528 550 PF00560 Leucine-rich repeat

IPR001611 551 572 PF00560 Leucine-rich repeat

IPR001611 573 595 PF00560 Leucine-rich repeat

IPR001611 604 625 PF00560 Leucine-rich repeat

IPR014045 719 961 PF00481 Protein phosphatase 2C

HMMSmart NULL 300 319 SM00364 NULL

NULL 323 342 SM00364 NULL

IPR003591 323 345 SM00369 Leucine-rich repeat

NULL 346 365 SM00364 NULL

IPR003591 346 368 SM00369 Leucine-rich repeat

NULL 369 388 SM00364 NULL

IPR003591 369 391 SM00369 Leucine-rich repeat

IPR003591 461 484 SM00369 Leucine-rich repeat

IPR003591 502 526 SM00369 Leucine-rich repeat

NULL 503 522 SM00364 NULL

NULL 526 545 SM00364 NULL

IPR003591 527 549 SM00369 Leucine-rich repeat

NULL 549 568 SM00364 NULL

IPR003591 551 571 SM00369 Leucine-rich repeat

IPR003591 574 594 SM00369 Leucine-rich repeat

NULL 574 590 SM00364 NULL

IPR003591 602 625 SM00369 Leucine-rich repeat

NULL 602 621 SM00364 NULL

NULL 625 644 SM00364 NULL

IPR003591 647 671 SM00369 Leucine-rich repeat

IPR001932 710 966 SM00332 Protein phosphatase 2C-related

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	574	587	PR00019	Leucine-rich repeat
IPR001611	602	615	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	302	323	PF00560	Leucine-rich repeat
IPR001611	325	346	PF00560	Leucine-rich repeat
IPR001611	348	369	PF00560	Leucine-rich repeat
IPR001611	371	392	PF00560	Leucine-rich repeat
IPR001611	442	464	PF00560	Leucine-rich repeat
IPR001611	528	550	PF00560	Leucine-rich repeat
IPR001611	551	572	PF00560	Leucine-rich repeat
IPR001611	573	595	PF00560	Leucine-rich repeat
IPR001611	604	625	PF00560	Leucine-rich repeat
IPR014045	719	961	PF00481	Protein phosphatase 2C
HMMSmart	NULL	300	319	SM00364	NULL
NULL	323	342	SM00364	NULL
IPR003591	323	345	SM00369	Leucine-rich repeat
NULL	346	365	SM00364	NULL
IPR003591	346	368	SM00369	Leucine-rich repeat
NULL	369	388	SM00364	NULL
IPR003591	369	391	SM00369	Leucine-rich repeat
IPR003591	461	484	SM00369	Leucine-rich repeat
IPR003591	502	526	SM00369	Leucine-rich repeat
NULL	503	522	SM00364	NULL
NULL	526	545	SM00364	NULL
IPR003591	527	549	SM00369	Leucine-rich repeat
NULL	549	568	SM00364	NULL
IPR003591	551	571	SM00369	Leucine-rich repeat
IPR003591	574	594	SM00369	Leucine-rich repeat
NULL	574	590	SM00364	NULL
IPR003591	602	625	SM00369	Leucine-rich repeat
NULL	602	621	SM00364	NULL
NULL	625	644	SM00364	NULL
IPR003591	647	671	SM00369	Leucine-rich repeat
IPR001932	710	966	SM00332	Protein phosphatase 2C-related

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGTCAGTCACACATAAGTTCC

Primer_r
: GTAAGATATGAGCCCACTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3952 bp
Genome contig ID	gi51511732r_70136393
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- AAAATAAAGTGGAATCTTTTTCATGGCTTTGTTTT
Flanking genome sequence (99939 - 99890)	----+--------+--------+--------+--------+----* AAAATGGAGTGCTTGTTATTTCATAAGTATTTTAGCATGAAGCTATAATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	70236332	70317366	21	99.0	Both No-hit

Primer_f	: AGTCAGTCACACATAAGTTCC
Primer_r	: GTAAGATATGAGCCCACTGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0931

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information